Monosynaptic Tracing Reveals Synaptic Connectivity Onto Postnatal-Born Granule Cells

Functional wiring in the olfactory bulb begins during embryogenesis and continues throughout postnatal life. Whereas embryonically derived interneurons of the MOB originate from the lateral ganglionic eminance and dorsal telencephalon [35]–[38], those born postnatally are generated exclusively from the subventricular zone (SVZ) of the lateral ventricle [39]–[42]. Although much is known about the cellular patterns of MOB interneuron development [35], [43], [44], the patterns of synaptic connectivity onto new granule cells are poorly understood. To determine the postnatal patterns of synaptic connectivity onto newborn granule cells, we performed in vivo monosynaptic circuit tracing [34]. For this we generated a conditional reporter mouse harboring a Cre/loxP-dependent allele (Figs. 1a, S1a, and S1b) capable of driving high levels of cytosolic tdTomato expression upon introduction of the plasmid G-IRES-TVA-IRES-Cre (Fig. 1b) that encodes components for targeted rabies virus (RV) infection, monosynaptic virus propagation, and Cre-mediated conditional reporter activation. In this design, neurons are genetically targeted for infection by expression of the TVA receptor, which binds selectively to RV particles pseudotyped with EnvA coat proteins [45]. Since the engineered RV mutant lacks the G coat protein, plasmid expression of the wildtype rabies-G coat protein enables precisely one round of “live” virus packaging and trans-synaptic infection of presynaptic cells [34], [46]–[50]. Retrograde spread of virus is strictly monosynaptic since only cells that receive G-IRES-TVA-IRES-Cre are capable of synthesizing live virus, whereas presynaptic targets do not contain the G protein and thus are incapable of producing infective RV particles. Replacement of the viral gene encoding the G capsid protein with an EGFP reporter renders presynaptic partners of RV-targeted cells brightly labeled [34], [51].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 1. Engineered Rabies Virus Allows Monosynaptic Circuit Tracing in Olfactory Bulb.

(a) Illustration of the ROSA26-stop^flox-tdTomato conditional knock-in allele. (b) Illustration of the tri-cistronic G-IRES-TVA-IRES-Cre expression construct used for electroporation into the subventricular zone (SVZ) of ROSA26-stop^flox-tdTomato mice. (c) Illustration of the in vivo electroporation procedure. Left, plasmid DNA encoding G-IRES-TVA-IRES-Cre was injected into the lateral ventricle of newborn mice. Middle, a square-pulse voltage was applied across the head to introduce the expression construct into SVZ progenitors. Right, 30 d following electroporation, pseudotyped SADΔG-EGFP RV was injected into the olfactory bulb for targeted infection of electroporated granule cells. (d) Diagram showing how pre- and postsynaptic neurons can be identified by two-color monosynaptic viral tracing in the conditional ROSA26-stop^flox-tdTomato background. Red cells represent conditional tdTomato reporter expression following G-IRES-TVA-IRES-Cre electroporation. Yellow cells represent electroporated cells that are also infected by SADΔG-EGFP RV. Green cells represent presynaptic targets of the infected granule cells. GL, glomerular layer; EPL, external plexiform layer; ML, mitral cell layer; IPL, internal plexiform layer; GCL, granule cell layer. (e) Schematic illustrating the estimated domain of SADΔG-EGFP RV infection with respect to the entire bulb. On average, infected granule cells were detected within 302 µm of the injection site (green circle)±214 µm (yellow outer circle). Scale bar, 300 µm. (f) Whole mount view of ROSA26-stop^flox-tdTomato mouse brain 30 d after unilateral G-IRES-TVA-IRES-Cre electroporation. Dashed line represents the coronal section imaged in (g)–(i). OB, olfactory bulb. Scale bar, 1 mm. (g) Coronal section through an electroporated and infected olfactory bulb showing tdTomato and SADΔG-EGFP expression. Scale bar, 300 µm. (h) Coronal section through the olfactory bulb of electroporated mice showing tdTomato-expressing granule cells at higher magnification. (i) Section shown in (h) imaged for SADΔG-EGFP following RV infection. (j) Merged view of (h) and (i). MC, mitral cell; GC, granule cell origin; dashed arrow, granule cell dendrite. Scale bar, 25 µm. (k)–(m) Dual tdTomato plus SADΔG-EGFP reporter expression, identifying a local granule cell microcircuit. (k) tdTomato expression in a single granule cell. (l) SADΔG-EGFP expression in the same ‘source’ granule cell shown in (k) and local presynaptic partners. (m) Merged reporter expression delineating source cell (yellow) and the local presynaptic partners (green). Short arrows in (k–m) point to the source granule cell. Scale bar, 10 µm.

https://doi.org/10.1371/journal.pone.0029423.g001

To test the functionality of our tracing system, we injected the G-IRES-TVA-IRES-Cre tri-cistronic construct into the lateral ventricles of embryonic day 14.5 (E14.5) ROSA26-stop^flox-tdTomato mice, electroporated neuronal progenitors in the ventricular zone, and made ex vivo cortical slice cultures [52] (Figs. S1c–i). After two days, EnvA-pseudotyped SADΔG-EGFP RV particles [34] were applied to cultured brain slices to infect neurons expressing G-IRES-TVA-IRES-Cre. Three days later, we observed widespread tdTomato expression throughout layers 4 and 5 and in the walls of the ventricles (Figs. S1c, S1f, and S1i), indicating neurons expressing Cre recombinase via the G-IRES-TVA-IRES-Cre cassette. In addition, we observed EGFP expression in a small number of tdTomato-positive neurons directly infected by SADΔG-EGFP RV, which appeared yellow (Figs. S1h and S1i). Finally, we observed a large cohort of EGFP-expressing neurons lacking tdTomato expression, showing trans-synaptic spread of SADΔG-EGFP RV to presynaptic partners of RV-infected cells (Figs. S1g–i).

After confirming that our tricistronic rabies G-IRES-TVA-IRES-Cre construct (Fig. 1b) functioned in conjunction with the ROSA26-stop^flox-tdTomato mouse line (Fig. 1a), we implemented this model system to examine the synaptic connectivity formed onto postnatal-born granule cells in the olfactory bulb. To target newborn granule cells for RV infection and subsequent monosynaptic tracing, we injected the G-IRES-TVA-IRES-Cre construct into the SVZ of postnatal day 2 (P2) mice and applied an external voltage across the brain to electroporate neuronal progenitors (Fig. 1c, left) [53]. After 30 d, at which point many of the electroporated cells have migrated to the MOB and formed functional synaptic connections [44], [54], EnvA-pseudotyped SADΔG-EGFP rabies virus was injected into the granule cell layer of the olfactory bulb to infect newly incorporated neurons expressing G-IRES-TVA-IRES-Cre (Fig. 1c, right). This experimental paradigm allowed us to probe the monosynaptic connectivity onto postnatal-born granule cells by directly visualizing vital fluorescence in neurons susceptible to pseudotyped RV infection (red), those that became infected (red and green, thus yellow), and presynaptic target neurons (green) (Fig. 1d). To target the electroporated granule cells for infection and monosynaptic tracing, we injected 250 µl the SADΔG-EGFP rabies virus 750 µm below the surface of the olfactory bulb, midway from the anterior and posterior boundaries. Although the methods of in vivo electroporation and viral infection are variable, by counting the number of infected source cells and determining the average bulbar volume spanned by these cells, we estimated viral spread and infection to encompass a spherical domain 300±200 µm in diameter (Fig. 1e, n = 10 labeled bulbs from 10 mice). To count labeled source cells, we made 100 µm slices through the entire bulb and identified all GCs that expressed both EGFP and tdTomato (n = 20–25 slices each, with the middle 3–5 slices harboring most of the labeled cells). Occasionally we infected periglomerular cells, which are also continually generated from electroporated SVZ [43]. In these instances we observed labeling of the cell types that contribute to the spherical glomerular structures (data not shown). To avoid infecting newborn periglomerular cells, we included a small volume (∼20 nl) of mineral oil in the tip of the injection pipette to prevent exposure of the virus while passing through the superficial bulb layers en route to the granule cell layer.

One week after RV infection, we processed the olfactory bulb and imaged fixed sections for reporter expression. Similar to what we observed in cortical slice explants (Fig. S1c–i), in vivo conditional reporter activation and trans-synaptic viral labeling was robust, and showed distinct patterns of presynaptic labeling (Figs. 1f–m). Although we began to observe viral-mediated EGFP in presynaptic target cells by 3 d following infection, high and stable levels of labeling were routinely achieved by 7 d. By 14 d post-infection, numerous presynaptic neurons showed abnormal morphologies, likely due to the extremely high levels of reporter expression driven by the RV genome. Thus, for all subsequent experiments, we chose 7 d post infection to investigate our presynaptic labeling. Since electroporation relies on generating a voltage across the ventricular space, injected DNA reproducibly showed unilateral patterns of reporter expression in the brain (Fig. 1f). This phenomenon was most obvious when imaging the conditional expression of tdTomato following transient introduction of Cre into the SVZ, which triggered tdTomato expression in neuronal progenitors that remained active in all daughter cells born from an electroporated lineage (Fig. 1g and 1h). Although this approach resulted in clonal labeling of many newborn granule cells with tdTomato, we were able to small numbers of postnatal-born granule cells for SADΔG-EGFP RV infection (Fig. 1i and 1j). This approach allowed us to resolve distinct clusters of presynaptic targets to electroporated granule cells (Fig. 1k–m). Based on the sparse infection by SADΔG-EGFP RV, the lack of infection points in close vicinity to one another, and the absence of clonal sectors (unlike those observed in cortical slices, Fig. S1), we reasoned that only a very small number of electroporated cells showed stable integration of the electroporated G-IRES-TVA-IRES-Cre plasmid. To further test this, we performed monosynaptic labeling of postnatal born granule cell networks while marking neuronal lineages born after electroporation with bromodeoxyuridine (BrdU) (Fig. S2a). At 14 d after electroporation, mice were supplemented with BrdU in their drinking water for 2 weeks to label all neurons born after that time, followed by RV infection and subsequent tissue processing. By comparing the number of green presynaptic inputs to the number of BrdU labeled green cells, we rarely ever observed newborn neurons that were doubly labeled (Fig. S2b–e). These data show that only a very small fraction of the tdTomato marked cells harbor the monosynaptic tracing components, and suggest that stable integration of our expression plasmid is rare and likely occurs in postmitotic neuronal precursors. By separately labeling primary points of infection (yellow source cells) and the cohort of neurons that provide their presynaptic input (green) (Fig. 1d), this modular virus-based molecular genetic system thus allowed us to directly visualize the synaptic microcircuits associated with postnatal-born granule cells.

Cohorts of Mitral Cells and Short Axon Cells Synapse Onto New Granule Cells

The full complement of neurons that contact newly integrated granule cells is unknown. In addition to dendrodendritic synapses formed between mitral/tufted cells and granule cells, it has recently been shown that granule cells form functional connections with multiple local interneuron cell types [24], [26]. After genetically targeting postnatal granule cells for SADΔG-EGFP RV infection, we observed extensive labeling throughout the granule cell, mitral cell, and external plexiform layers (EPL) in neurons presynaptic to electroporated granule cells. Interestingly, we noted clustered patterns of connectivity (Fig. 2a). These clustered networks contained mitral cells [55] (Fig. 2b) and other inframitral layer cells that morphologically corresponded to both superficial and deep short axon cells (SACs) (Figs. 2c and 2d). By restricting rabies-G, TVA, and Cre expression to postnatal-born interneurons through timed in vivo electroporation, we never observed conditional tdTomato reporter expression in cell types other than periglomerular and granule cells. Further, we never observed trans-synaptic labeling between granule cells born after electroporation (Fig. S2 and data not shown), arguing against nonspecific RV uptake through proximity spillover.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. SADΔG-EGFP RV is Retrogradely Transported from Granule Cells to Presynaptic Targets in Olfactory Bulb.

(a) A coronal section of olfactory bulb following monosynaptic viral tracing showing a clustered pattern of presynaptic labeling. The dashed line shows the midline through a coronal section of MOB. Scale bar, 100 µm. (b) SADΔG-EGFP expression in presynaptic mitral cells. Scale bar, 25 µm. (c)–(d) SADΔG-EGFP expression in short axon cells in the external plexiform and granule cell layers (hatched yellow boxes). Scale bars, 20 µm. (e)–(g) Partial colabeling of calretinin in SADΔG-EGFP expressing cells. Scale bar, 20 µm. (h)–(j) Partial colabeling of parvalbumin in SADΔG-EGFP expressing cells. Scale bar, 20 µm. (k)–(m) Overlapping expression of GABA_A R α1 in SADΔG-EGFP labeled short axon cells. Scale bar, 15 µm. (n)–(p) SADΔG-EGFP expressing cells do not express tyrosine hydroxylase, and thus are not periglomerular. Dashed arrows point to a tyrosine hydroxylase positive cell not labeled by SADΔG-EGFP RV. Scale bar, 20 µm. (q)–(s) Expression of GFAP in occasional SADΔG-EGFP labeled glial cells. Scale bar, 10 µm. Arrows point to overlapping marker expression in SADΔG-EGFP labeled cells. For all panels, GL, glomerular layer; EPL, external plexiform layer; ML, mitral cell layer; GCL, granule cell layer.

https://doi.org/10.1371/journal.pone.0029423.g002

Varying the amount of pseudotyped RV that was injected into the MOB allowed us to control the number of virally infected source cells. Levels of viral infection ranged from very low (100 nl) (Figs. 1k–m) to high (500 nl) (Fig. 2a), and thus could be adjusted for optimal microcircuit analysis. For our experiments, we used conditions (250 nl) that achieved a moderate level of labeling (see Fig. 1e and Experimental Procedures) to facilitate source cell and presynaptic partner identification. To validate the retrograde trans-synaptic transport of SADΔG-EGFP RV, we examined EGFP expression in cortical brain regions known to send long-range centrifugal inputs to the MOB and make synapses onto granule cells [13], [56]. Consistent with the known presynaptic transport of RV, we observed strong SADΔG-EGFP expression in neurons of the anterior olfactory nucleus (AON), horizontal limb of the diagonal band nucleus (HDB), and piriform cortex (Fig. S3). Moreover, a complete absence of EGFP label in olfactory sensory neurons (OSNs), which heavily innervate the MOB and synapse onto mitral cells, confirmed that viral labeling stops after one presynaptic connection (data not shown). Together these data show that postnatal-born granule cells can be precisely targeted for RV infection, demonstrate both short- and long-range synaptic connectivity onto postnatal-born granule cells, and reveal clustered patterns of organization intrinsic to granule cell microcircuits.

To further investigate the repertoire of cells presynaptic to postnatal born granule cells, we performed immunohistochemical analysis on thin sections of MOB and counted the number of EGFP-positive, RV-infected neurons that were negative for tdTomato (hence, presynaptic to Cre-expressing granule cells) using molecular markers expressed by olfactory bulb cell types [57]. To begin to elucidate the molecular identity of the cells presynaptic to newborn granule cells, we made 50 µm sections through the labeled domain of the MOB (average 6 sections per bulb), performed immunohistochemistry, and counted EGFP labeled cells to determine the percentage of cells that showed overlapping expression of various interneuron markers. Whereas only a subset of EGFP-positive cells expressed the interneuron markers calretinin (46±5% EGFP-positive cells, n = 100 cells in 18 sections from 4 mice; Figs. 2e–g) and parvalbumin (55±7%; Figs. 2h–j), we routinely observed co-expression of the GABA_A receptor subunit α1 (84±4%; Figs. 2k–m), which is highly and selectively expressed in SACs residing within inframitral cell layers [57]. Thus, through immunohistochemical analysis against interneuron markers in the olfactory bulb, ∼50% of the SADΔG-EGFP labeled cells expressed parvalbumin and/or calretinin, whereas >80% of the local presynaptic inputs expressed GABA_A receptor subunit α1. We never detected SADΔG-EGFP expression in cell types that express tyrosine hydroxylase in the upper EPL or glomerular cell layer (Figs. 2n–p). Interestingly, we occasionally observed SADΔG-EGFP expression in proximate glial cells that were directly contacting source granule cell (GC) dendrites, as shown by colocalization with glial fibrillary acidic protein (GFAP) (Figs. 2q–s), suggesting a potential role for glial contact in synapse remodeling of newborn granule cells [58]–[60]. Together, these data show that, in addition to forming well-described contacts with centrifugal inputs and dendrodendritic synapses with mitral and tufted cells, postnatal-born granule cells receive extensive input from local SACs in the MOB.

To more closely examine the connectivity made between granule cells and their presynaptic partners, we took advantage of the dual-color labeling scheme of our experimental system to count the number and types of neurons that were labeled with SADΔG-EGFP RV by monosynaptic transfer. Given that all granule cells targeted for G-IRES-TVA-IRES-Cre electroporation express tdTomato (red), and only a subset of those cells became infected by injected SADΔG-EGFP RV (red and green, thus yellow), presynaptic targets can be clearly identified by the presence of only EGFP (green) (Fig. 1d). From our immunohistochemical data identifying the majority of non-mitral cell presynaptic neurons as SACs (Figs. 2c and 2d), we sought to determine the relative connectivity of SACs onto new granule cells. We counted doubly labeled (yellow) granule source cells and all of their green presynaptic neuronal partners in 100 µm thick serial sections of entire olfactory bulbs. On average we identified 33±8.1 doubly labeled source cells per bulb. Interestingly, we found that the ratio of presynaptically labeled short axon cells to RV-infected granule cells was quite high (4.6±0.8, SEM, n = 7 olfactory bulbs), revealing a previously unappreciated level of local SAC input to newborn granule cells.

We next investigated the clustered architecture of SACs presynaptic to newly integrated GCs. For this, we selected olfactory bulb tissue that had relatively sparse SADΔG-EGFP RV infection and presynaptic labeling in order to facilitate the imaging of labeled SAC to GC microcircuits with cellular resolution (Figs. 3a–c). To determine the relative numbers, locations, and types of presynaptic neurons that contribute to the clustered network, we prepared semi-thick brain slices (150–200 µm) that were optically cleared in glycerol for z-stack confocal imaging and 3-dimensional volume rendering [61]. To quantify the inputs to granule source cells, we took serial image planes through the slices at 2 µm intervals, counting all doubly labeled and green-only neurons to determine the ratio of presynaptic inputs to granule source cells. In addition to clearly identifiable mitral cells (Fig. 2a–d), reconstructed image stacks revealed two main populations of SACs which have been previously characterized as deep SACs and superficial SACs [24], [57], [62]. Quantitative analysis revealed 5.6±1.5 SACs per resolvable clustered network (Fig. 3d), and an average width of the network (including SAC cell bodies and proximal dendrites) of 148.5±40.6 µm (n = 10 SAC/GC networks from 4 bulbs, of 4 mice ± SEM). Neurons presynaptic to individual GCs were categorized as SACs by morphology, molecular marker analysis, and electrophysiological properties (Fig. 2 and Fig. 3d–f), whereas the widths of GC-SAC networks were determined by the measuring the lengths of clearly resolvable SAC dendrites. Consistent with previous reports [24], [63], presynaptic deep SACs showed low frequency trains of action potentials with depolarizing current injections, whereas superficial SACs responded with high frequency patterns of firing (Fig. 3e–f). It is unlikely that our viral labeling identifies the full complement of functional synapses onto postnatal-born granule cells due to the unknown efficacy of particle transfer. In addition, it is likely that we underestimated the width of a functional MOB cluster by not including distal SAC axonal arbors in our characterization due to the lack of fine resolution imaging in thick brain slices. Altogether, these data reveal an unexpected and extensive local connectivity between SACs and newly integrated granule cells in olfactory bulb.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. Newborn Granule Cells Receive Extensive Input from Short Axon Cells.

(a)–(c) An SADΔG-EGFP labeled olfactory bulb microcircuit in which pre- and postsynaptic cell types can be identified by differential reporter expression. Electroporated cells appear red due to Cre activation of tdTomato expression. SADΔG-EGFP infected source cells appear yellow due to co-expression of tdTomato and EGFP. Presynaptic partners become trans-synaptically infected with SADΔG-EGFP but lack Cre and thus appear green. The dashed arrow points to a mitral cell, MC. Arrows point to short axon cells, SACs. Arrowheads indicate a source granule cell, GC. For (a)–(d): EPL, external plexiform layer; ML, mitral cell layer; GCL, granule cell layer. (a) tdTomato expression (red) in recombined Cre-expressing granule cells. (b) SADΔG-EGFP expression in a granule source cell (arrowhead) and its presynaptic targets (arrows). (c) Merge of (a) and (b). Scale bar, 20 µm. (d) Examples of volume-rendered reconstructions showing local short axon cell microcircuits with synaptic contacts onto newborn granule cells. The postsynaptic granule cells are shown in red, and the presynaptic short axon cells are shown in green. Scale bar, 15 µm. (e)–(f) Examples of action potential responses to depolarizing current injection and images of the short axon cell types observed to make synaptic contacts onto newborn granule cells. Shown are firing responses (left) and cellular morphologies (right) of a representative deep short axon cell (e) and superficial short axon cell (f) with contacts onto a newborn granule cell. Scale bars, 15 and 10 µm, respectively.

https://doi.org/10.1371/journal.pone.0029423.g003

Odor Enrichment Increases SAC-GC Connectivity in the Olfactory Bulb

To examine how sensory experience influences granule cell microcircuits, we analyzed the patterns of connectivity between granule cells and their presynaptic targets following olfactory stimulation. We concentrated on synaptic input from SACs as these cells were robustly labeled using RV monosynaptic tracing (Figs. 2, 3). To provide a broad palette of odors for long-term sensory enrichment, we designed a robotic system for continuous cycled delivery of multiple odorants to freely exploring mice (see Fig. S4 and methods). For odor enrichment, ROSA26-stop^flox-tdTomato mice were subjected to in vivo SVZ electroporation with G-IRES-TVA-IRES-Cre and reared with their mothers for 30 d in cages ported for odor delivery (Fig. S4). After the 30 d odor stimulation period, SADΔG-EGFP RV was injected into the granule cell layer of the olfactory bulb, and 7 d later the olfactory bulb was dissected and sectioned to count dual-labeled (yellow) granule cells and their single-labeled (green) presynaptic partners (Fig. 4a). Odor exposure induced a dramatic increase in the number of SACs presynaptically coupled to new granule cells compared to the non-odor enriched control group (Figs. 4b and 4c). Specifically, odor stimulation tripled the connectivity ratio of SACs onto source GCs (control, 4.6±0.8; odor-enriched, 13.8±1.0; n = 3 bulbs from 3 mice, ± SEM) (Fig. 4d). On average, we counted 48±14 doubly labeled source cells per bulb in mice subjected to odor enrichment. The increase in labeled presynaptic partners was not simply a reflection of an increased absolute number of new granule cells since the quantification normalizes to the number of labeled granule cells. Thus, odor enrichment enhances SAC connectivity onto new granule cells.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Odor Enrichment Increases SAC Connectivity onto Granule Cells.

(a) Schematic of experimental paradigm to track changes in granule cell connectivity following odor enrichment. (b) Dual labeled region of a control olfactory bulb showing SADΔG-EGFP expression in presynaptic targets. Scale bar, 10 µm. (c) Dual labeled olfactory bulb from a mouse subjected to odor enrichment showing increased presynaptic labeling (green). Arrows points to source granule cells (GC) which appear yellow due to co-expression of tdTomato and EGFP. Presynaptic partners appear green. Scale bar, 10 µm. EPL, external plexiform layer; ML, mitral cell layer; GCL, granule cell layer. (d) Connectivity ratio between postsynaptic granule cells and presynaptic short axon cells (SAC∶GC) under control conditions or following odor enrichment. ^*p<0.01, Student's t-test.

https://doi.org/10.1371/journal.pone.0029423.g004

One possible explanation for the increased labeling of presynaptic cells upon odor stimulation is that elevated neuronal activity enhances RV transfer at existing synapses. To address this issue, we prepared olfactory bulb explants from mice that had been electroporated with a plasmid encoding the monosynaptic tracing components, infected with the SADΔG-EGFP RV, and cultured in the presence of pharmacological agents to block synaptic transmission. We found that blocking SNARE-dependent neurotransmitter release, action potentials, or fast glutamatergic neurotransmission had no significant effect on the number of monosynaptically labeled cells compared to untreated controls (Fig. S5). Thus, trans-synaptic transfer of RV is insensitive to activity manipulations over several days in vitro, and we conclude that the odor-induced expansion in granule cell circuit labeling in vivo (Figs. 4c and 4d) is attributable to changes in the number of synaptic inputs per granule cell, rather than to alterations in the effectiveness of RV transfer between neurons following olfactory stimulation. Consistent with this notion, we observed morphological differences in the granule cells themselves. Doubly labeled granule source cells in the bulbs of mice that were reared in odor enriched environments showed a significant increase in the number of dendritic protrusions (control, 8.4±0.7 per 25 µm dendrite, n = 17 doubly labeled neurons from 3 mice; odor, 12.7±0.9; n = 18 doubly labeled neurons from 4 mice; p<0.01; Figs. 5a and 5b). We also noted a significant increase in the number of inhibitory synapses on the dendrites of source granule cells by staining for the inhibitory synapse marker gephyrin (control, 7.8±0.9 gephyrin clusters per 35 µm dendrite; odor, 11.9±1.3; n = 12 neurons from 3 bulbs each; p<0.02; Figs. 5c and 5d). To restrict our analysis to synaptic changes in postnatal born neurons, gephyrin-positive puncta were only counted if they could be clearly colocalized within doubly labeled granule source cells. Corresponding to enhanced SAC input onto granule cells following odor enrichment, we also noted increased mitral cell input (data not shown). Given these findings, we cannot rule out that a portion of the gephyrin-positive puncta may indeed correspond to increased centrifugal input from other inhibitory cell types. Nonetheless, these data support increased presynaptic input onto newborn neurons following odor enrichment, and reveal activity-induced expansion of SAC circuitry.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Odor Stimulation Increases Synaptic Inputs onto Newborn Granule Cells.

(a) Dendrites from granule cells in control or odor exposed mice showing the increased number of spines following odor enrichment. Yellow arrows point to individual spines. Scale bar, 3 µm. (b) Data represent means ± SEM of spine number per 25 µm dendrite on granule cells in mice exposed to cycled odorants (odor) compared to non-odor exposed controls. ^*p<0.001, Student's t-test. (c) Gephyrin labeling to reveal inhibitory GABAergic synapses on control granule cell dendrites. Insets in (c) and (d) show tdTomato expression in doubly labeled dendrites. Scale bars, 2 µm. (d) Increased number of gephyrin labeled inhibitory synapses contacting dendrites of granule cells from mice subjected to odor enrichment.

https://doi.org/10.1371/journal.pone.0029423.g005

SACs provide GABAergic inhibitory input onto MOB granule cells [24], [26], [64]. We next tested whether the odor-induced increase in both RV-labeled SACs presynaptic to GCs and gephyrin-labeled inhibitory synapses onto GCs corresponds with changes in functional synaptic connectivity. To this end, we performed whole-cell patch clamp recordings in acute brain slices from labeled MOB granule cells following in vivo postnatal electoporation and measured miniature inhibitory postsynaptic currents (mIPSCs). Consistent with the observed increase in gephyrin puncta (Figs. 5c,d), odor stimulation significantly increased mIPSC frequency in postnatal born granule cells (Fig. 6). Whereas mIPSC amplitudes were similar between experimental groups (control, 15.2±1.4 pA; odor, 14.4±1.3 pA; Fig. 6b), mIPSC frequency was increased in odor-exposed animals (control, 0.55±0.06 Hz, n = 9 cells from 3 mice; odor, 0.89 Hz±0.07, n = 10 cells from 4 mice, p<0.01, unpaired t-test; Fig. 6a). Taken together, these data show that sensory experience expands connectivity between short axon cells and new granule cells, defining a novel cell type-specific reorganization of olfactory circuits in response to odor-induced activity.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 6. Odor Enrichment Increases Inhibitory Drive Onto Newborn Granule Cells.

(a)–(b) Quantitative analysis of (a) average frequency and (b) amplitude of mIPSCs recorded from labeled granule cells in control and odor-enriched mice. Odor enrichment increased the frequency, but not amplitude, of granule cell mIPSCs (control, n = 9; odor, n = 10, ^*p<0.01, unpaired t-test). (c) Representative voltage-clamp recordings of mIPSCs from granule cells in acute MOB slices from control and odor-enriched mice.

https://doi.org/10.1371/journal.pone.0029423.g006

Short Axon Cell Input onto Granule Cells

Implementing a highly selective in vivo genetic targeting strategy, we investigated the synaptic patterns of connectivity that are made between postnatal-born granule cells and their presynaptic targets using engineered rabies virus for monosynaptic circuit tracing. Our experimental design enabled us to selectively target granule cells for rabies infection and propagation via in vivo electroporation [53], allowing direct determination of the cell types presynaptic to targeted granule cells. Using this approach, we observed discrete synaptic networks associated with granule cell microcircuits. Surprisingly, the majority of neurons making local presynaptic inputs onto postnatal-born granule cells were identified as SACs in the granule cell and external plexiform layers of the olfactory bulb.

Recent morphological and electrophysiological studies have shown that SACs elaborate axonal arborizations throughout all layers of the olfactory bulb, are presynaptic to resident granule cells, and provide GABAergic input that modulates granule cell firing [24], [26], [57]. Interestingly, the superficial SACs we have identified in this study display morphological and electrophysiological characteristics similar to Van Gehuchten neurons, which express many of the same molecular markers as deep SACs, but are thought to make contacts on both GCs and mitral cells, and are axon-less [62]–[66]. These properties suggest that SACs provide spatial refinement of local inhibitory circuits that sculpt the firing properties of mitral cells. In other brain areas, GABAergic input during neuronal development contributes to cell differentiation, survival, and circuit maturation [67]–[71]. Given ongoing adult neurogenesis, resident short axon cells in the mature olfactory bulb may similarly contribute to dynamic remodeling, differentiation, or survival of newly incorporated granule cells [43], [72]. Thus, in addition to providing inhibitory control over dendrodendritic synapses in the mature circuit, SACs may regulate synaptic integration of newborn granule cells through developmental signaling mechanisms. In such a scenario, odor enrichment would not only modify network activity in the bulb, but also promote GABAergic input onto new GCs from select cohorts of SACs. These odor networks may serve as hubs of activity that are more favorable or attractive for newborn neuron synapse formation and survival. More refined modes of circuit activity manipulations using cell type-specific chemical genetic or optogenetic manipulations will be required to fully address this notion [46].

Our experimental approach was effective in demarcating presynaptic cell types known to make functional connections onto postnatal-born granule cells, including centrifugal input from olfactory cortex, mitral/tufted cells, and SACs. The extensive connectivity made by SACs onto granule cells raises the question of the identity of neurons that are presynaptic to SACs. What cell types drive the inhibitory influence that SACs in turn relay onto granule cells? Although it has been proposed that mitral cells could serve this role [24], direct evidence in support of this model is lacking. Future genetically targeted monosynaptic tracing would be well suited to address this question. Another intriguing observation was the viral labeling of certain sparse glial cells found to be in direct physical contact with granule “source” cells. Such labeling could be due to uptake of viral particles at neuron-glia contacts. Indeed newborn neocortical neurons are known to form transient gap junction contacts onto radial glia [73], and functional neuron-glia synapses have been described [74], [75]. Alternatively, glial labeling could arise by selective engulfment or uptake of cell remnants during apoptosis or synapse pruning [76], [77]. It will be important for future studies to examine the electrophysiological and ultrastructural nature of this neuron-glia interaction.

Odor Experience Expands Olfactory Bulb Circuitry

SACs are born during embryonic development and are resident prior to either sensory input or granule cell integration [35], [78]. Thus, the clustered organization onto granule cells may reflect developmental patterning events that occur during forebrain maturation, or alternatively may represent local connectivity that is elaborated or pruned in response to patterns of sensory experience or glomerular activity. In our experimental system, we observed clustered SAC inputs onto granule cells in both unstimulated controls and odor-enriched groups. However, in addition to the known enrichment of postnatal-born neurons that become integrated into olfactory bulb circuits following odor stimulation [7], [31], we have found that the number of neurons forming functional presynaptic inputs onto individual granule cells is also dramatically increased following odor enrichment. This increased level of presynaptic input onto postsynaptic granule source cells was revealed by greater numbers of labeled presynaptic targets, morphological changes in postsynaptic spine structures and inhibitory scaffolds, as well as increased inhibitory drive. The presence of more presynaptic inputs onto newborn GCs does not necessarily imply a linear increase in cell-to-cell connectivity. That is, in response to odor stimulation additional presynaptic cell types could form synaptic connections without an overall change in the absolute number of synapses onto a GC, provided that the overall connectivity ratio for any given presynaptic target cell decreases. Although the focus of our analysis was on the increased number of inputs onto GCs by SACs, we also observed an increase in the number of labeled presynaptic mitral cells (data not shown). It is likely that the changes we observe in cellular morphology and electrophysiological output in response to odor enrichment reflects a composite of expanded connectivity from not only the SACs, but also mitral cells and centrifugal inputs. In the present study, we have shown that presynaptic connectivity made onto newborn granule cells by SACs is significantly increased in response to sensory stimulation, suggesting they play a pivotal role in the capacity for postnatal-born neurons to integrate within the intact brain. It will be important for future studies to determine, in detail, how the complete repertoire of presynaptic inputs is tuned by sensory experience. Thus, in addition to increasing the number of newly incorporated granule cells [4], [7], [31], [79], sensory experience recruits additional presynaptic elements that contact each granule cell. Such augmented integration may contribute to the high degree of cellular plasticity in this region of the brain and the improved sensory discrimination observed upon odor enrichment [4].

Our slice explant experiments suggest that synaptic transfer of RV is independent of action potentials, VAMP-mediated synaptic release, and fast glutamatergic neurotransmission and thus reflect changes in physical network connectivity. Indeed, odor stimulation increased both spine density and inhibitory synapses on new granule cells, consistent with an expansion of presynaptic input. It remains to be determined if the circuit changes we observed in our experimental paradigm result in long-term structural changes that persist throughout the life of an animal, or represent transient connections that become pruned or lost in the absence of continued odor experience. Our current method of labeling presynaptic inputs is irreversible, and it will be important for future long-term tracing studies to examine the temporal course of granule cell circuit plasticity in response to odor enrichment or deprivation. Such an analysis may require new technologies for repeated genetic labeling of presynaptic partners onto defined cell populations over time.

Our present study has demonstrated the power of new genetic technologies to define neural circuits in vivo. The olfactory system is an unusually plastic region of the mammalian brain, capable of continued addition and removal of cell cohorts, with accompanied synapse and circuit remodeling into adulthood. Our results indicate that sensory experience promotes the synaptic integration of new neurons into extensive, spatially organized, cell type-specific olfactory circuits, providing a tractable in vivo model to better understand how activity influences complex neural circuit formation. Moreover, adult-born neurons normally destined for the olfactory bulb can reroute to lesion sites in the neocortex and striatum [80], [81], suggesting that the mechanisms of plasticity innate to this renewable cell type may be harnessed for tissue repair. More broadly, monosynaptic tracing in vivo provides a powerful approach to map global connectivity of newly integrated neurons during development, plasticity, and regeneration.

Expression Plasmid Construction

To generate the pCAG-Rabies G-IRES-TVA construct, the cDNA encoding rabies G was excised from pHCMV-RabiesG [82] and cloned into a modified pCIG backbone [83]. For bi-cistronic expression of the TVA receptor, the TVA cDNA from pCMMP-TVA800 [84] was PCR amplified and cloned downstream of an IRES2 element (Clontech, Mountain View, CA) for insertion 3′ to rabies G. For tri-cistronic expression of Cre recombinase, IRES-Cre [85] was inserted downstream of rabies G-IRES-TVA to generate pCAG-rabies G-IRES-TVA-IRES-Cre.

Generation of ROSA26-stop^flox-tdTomato Mice

A 1.6 kb cDNA fragment encoding the tdTomato protein (provided by Roger Tsien, UCSD) was PCR amplified and cloned upstream of the polyA signal sequence of pCRII. The tdTomato-polyA construct was verified by sequencing. We next constructed a shuttle vector by first cloning the tdTomato-polyA cDNA into the pBigT vector [86] and inserting the CAG promoter element using PacI upstream of the loxP-stop-loxP sequence. We then moved the CAG-loxP-stop-loxP-tdTomato-polyA cassette into the pROSA-acceptor targeting plasmid as previously described [87] to generate the ROSA-CAG-loxP-stop-loxP-tdTomato targeting vector. This targeting construct was linearized and electroporated into E14 ES cells [88]. Following selection, clones were picked and screened for the recombined allele by southern blotting. For southern blots, ES cell genomic DNA was digested with EcoRV, transferred, and hybridized with an external probe to the ROSA26 locus. The wildtype allele gave an 11.5 kb fragment, whereas a 5.7 kb band detected the mutant allele. Using standard procedures [89], positive ES cell clones were used to generate gene-targeted mice. The resulting offspring were genotyped by PCR. To detect both the wildtype and targeted alleles, the following PCR primers were designed for multiplexing: Rosa/01, 5′-CACTTGCTCTCCCAAAGTCG -3′; Rosa/02, 5′-TAGTCTAACTCGCGACACTG -3′; CAG/02, 5′- GTTATGTAACGCGGAACTCC -3′. The wild type allele produced a ∼560 bp fragment with Rosa/01 and Rosa/02 primers, whereas the mutant allele was detected by a ∼300 bp fragment with Rosa/01 and CAG/02 primers.

In Vivo Electroporation and RV Labeling of Postnatal-Born Granule Cells

Newborn mice were anesthetized by brief hypothermia. Then, 500 nl of 1 µg/µl endotoxin-free plasmid DNA was injected unilaterally into the right lateral ventricle using a Hamilton syringe with a custom beveled 33-gauge needle (Hamilton Company, Reno, NV). Electroporation was carried out by applying multiple voltage pulses across the width of the newborn heads, just posterior to the eyes, using circular 7 mm tweezertrodes and a BTX ECM 830 square wave electroporator (Harvard Apparatus, Holliston, MA). The electroporation parameters included 5 pulses of 150 V for 50 ms each with 950 ms intervals. Immediately after the procedure, electroporated mice were returned to a heated home cage and monitored until recovery. At 30 d following the electroporation procedure, 250 nl (6×10³ particles/µl) of pseudotyped SADΔG-EGFP RV was injected into the granule cell layer of the olfactory bulb using glass injection pipettes and a Nanoject II (Drummund Scientific Company, Broomall, PA). We targeted injection at the midpoint of the olfactory bulb 750 µm below the surface of the brain. This yielded a volume of infection spanning ∼300 µm in diameter±200 µm (see Fig. 1e). At 7 d post-infection, olfactory bulbs were dissected and prepared for image analysis.

Electroporation and Organotypic Slice Cultures

Organotypic brain slices were prepared and cultured as previously described [52] with minor modifications. For ex vivo slices, dorsal telencephalic progenitors were labeled by injecting pCAG-Rabies G-IRES-TVA-IRES-Cre plasmid DNA (0.1 mg/ml) diluted in a 0.1% Fast Green solution into the lateral ventricles of decapitated E14.5 ROSA26-stop^flox-tdTomato mouse heads. The solution was delivered with a small glass capillary pipette attached to a Picospritzer II (General Valve Corp., Fairfield, NJ) using five 15-psi pulses lasting 4 ms each. Electric potentials were generated across intact heads using gold-coated electrodes attached to an ECM 830 electroporator with the following parameters: four 100 ms 45 V pulses separated by 100 ms intervals. Immediately after electroporation, brains were dissected, vibratome sectioned at 250 µm, and maintained as interface organotypic cultures prior to fixation and immunohistochemical labeling. For acute olfactory bulb slices, wildtype newborn mice were electroporated as described above with a DNA plasmid encoding EF1α-tdTomato-P2A-Rabies G-IRES-TVA-WPRE-pA. 10 d later, brains were dissected, vibratome sectioned at 250 µm, infected with virus, and maintained as interface organotypic cultures. The next day pharmacological agents including one or more of TTX (1 µM, Sigma), botulinum toxin A (50 nM, Sigma), tetanus toxin (50 nM, Sigma), APV (50 µM, Tocris), or CNQX (50 µM, Tocris) were added to the culture media and re-administered every 24 h for 5 d. Slices were then fixed, imaged, and counted for fluorescently labeled cells.

Confocal Imaging and Immunohistochemistry

Experimental mice were sacrificed, perfused with 4% paraformaldehyde in phosphate buffered saline, dissected to remove intact brains, and post-fixed for 1 h at 4°C. Brain tissue was embedded in O.C.T and either sectioned to 12 µm on an upright Leica cryostat, or 50–100 µm slices were cut on a cooled stage microtome. Tissue sections were mounted on slides and imaged using an upright Zeiss 510 scanning confocal microscope (Carl Zeiss Inc.). For immunohistochemistry, sections were incubated with blocking solution (10% normal goat serum, 2% BSA, 0.1% Triton X-100 in PBS pH 7.4) and incubated at 4°C for 2 h. Mouse monoclonal anti-calretinin (1∶1500; Millipore, Temecula, CA), rabbit polyclonal anti-GABA_A α1 (1∶1000; Covance), rabbit polyclonal anti-GFAP (1∶1500; Abcam, Cambridge, MA), guinea pig polyclonal anti-parvalbumin (1∶500, Millipore, Temecula, CA), monoclonal anti-gephyrin (1∶2000; Synaptic Systems, Germany), or rabbit polyclonal anti-tyrosine hydroxylase (1∶2000; Novus, Littleton, CO) antibodies were diluted in blocking solution and applied overnight at 4°C. The next day, sections were washed 3×15 min each in PBS with 0.1% Triton X-100, followed by 2×15 min in blocking solution. Secondary Alexa-633 goat anti-rabbit IgG, Alexa-647 donkey anti-mouse, or Alexa-633 goat anti-guinea pig antibodies (Invitrogen, Carlsbad, CA) were then added to a final dilution of 1∶500 and incubated for 4 h at 4°C. Sections were then washed 4×15 min each and mounted with DAPI-containing Vectashield mounting medium (Vector Laboratories, Burlingame, CA). Immunoreacted slides were imaged the same as unprocessed tissues.

Odor Enrichment

Odor enrichment was carried out using similar parameters as previously described [90]. For controlled odor delivery, a liquid-dispensing robot (model 7200; I & J Fisnar, Fair Lawn, NJ), was programmed to cycle through 42 vials containing different odorant mixtures continuously for 4 weeks following electroporation. Odorants were presented for 5 s each, followed by a 1 min clean air exposure at a flow rate of 0.2 L/min. Odorants were diluted in mineral oil according to their individual vapor pressures to give a nominal headspace concentration of 100 ppm. Further flow diluted the odorants to a nominal final vapor phase concentration of ∼10 ppm. For mixture stimuli, compounds were diluted to the same final delivery concentration.

Slice Electrophysiology