Table 2.

RT-qPCR primer sequences

Target nameSequenceDirectionSource
Eef1a1 CAACATCGTCGTAATCGGACAFwdPrimerBank, Harvard
  GTCTAAGACCCAGGCGTACTTRev 
Rpl29 CAAGTCCAAGAACCACACCACFwdPrimerBank, Harvard
  GCAAAGCGCATGTTCCTCAGRev 
Pax6 TACCAGTGTCTACCAGCCAATFwdPrimerBank, Harvard
  TGCACGAGTATGAGGAGGTCTRev 
Emx1 GAAGAATCACTACGTGGTGGGFwdTerrigno et al. (2008)
  CCGTTTGTATTTTGTCCTCCGARev 
Emx2 GGCTAGAGCACGCTTTTGAGFwdTerrigno et al. (2008)
  CACCGGTTAATGTGGTGTGTRev 
Mtap2 CTCCTCGCAGGGGTGTATCAFwdPrimerBank, Harvard
  GTCCGTCGTGCTGAAGAGARev 
Tbr1 CGCCCTCCTCCATCAAATCCATCGFwdTerrigno et al. (2008)
  GCAGTTCTTCTCGCAGTCCCGCRev 
Reln TTACTCGCACCTTGCTGAAATFwdPrimerBank, Harvard
  CAGTTGCTGGTAGGAGTCAAAGRev 
Sat2b GCCGTGGGAGGTTTGATGATTFwdPrimerBank, Harvard
  ACCAAGACGAACTCAGCGTGRev 
Cux1 TGACCTGAGCGGTCCTTACAFwdPrimerBank, Harvard
  TGGGGCCATGCCATTTACATCRev 
Lhx9 TCCAAAACGCACGAGCCAAFwdTerrigno et al. (2008)
  CAGGTCTGTTAAAGTGGTCGCRev 
Lmo3 ACACGAAGGCTAACCTTATCCTFwdTerrigno et al. (2008)
  AGTTTCCCGTTACACCAAACAGRev 
Gap43 TGGTGTCAAGCCGGAAGATAAFwdPrimerBank, Harvard
  GCTGGTGCATCACCCTTCTRev 
Slc17a6 CTGAGAAGAAGGCTCCGCTATFwdPrimerBank, Harvard
  ATGCCGAAGGATATGCAGAAGRev 
Slc32a1 ACCTCCGTGTCCAACAAGTCFwdPrimerBank, Harvard
  TCAAAGTCGAGATCGTCGCAGRev 
Tubb3 GCCAAGTTCTGGGAGGTCATFwdPrimerBank, Harvard
  GGGCACATACTTGTGAGAGGARev 
Gfap ACCAGCTTACGGCCAACAGFwdPrimerBank, Harvard
  CCAGCGATTCAACCTTTCTCTRev 
Bcl11b CCCGACCCTGATCTACTCACFwdPrimerBank, Harvard
  GGAGGTGGACTGCTCTTGTRev 
Nes CCCCTTGCCTAATACCCTTGAFwdPrimerBank, Harvard
  GCCTCAGACATAGGTGGGATGRev 
Foxg1 CACTTTGAGTTACAACGGGACCFwdPrimerBank, Harvard
  CGAGTTTTGAGTCAACACGGARev