Table 1.

M. domestica specific primers used in RT-PCR experiments

GeneSequence (5’-3’)
GAPDHForward: TAAATGGGGAGATGCTGGAG
Reverse: GCCAGCATCGAAGGTAGAAG
TRPM8Forward: GGTCATTTGGGAGCAGACGA
Reverse: ATCCATGAGCAGCACGTAGG