Table 1.

qRT-PCR primers used in this study

Gene IDFWD/REVSequence (5’–3’)
PpiaFWD GAGCTGTTTGCAGACAAAGTTC
REV CCCTGGCACATGAATCCTGG
C3FWD GAGGCACATTGTCGGTGGTG
REV CCAGGATGGACATAGTGGCG
C3ar1FWD CTCAGCAACTCGTCCAATGC
REV CCATGGCTCAGTCAAGCACA
C5ar1FWD CTTCCTTCAGAAGAGTTGCCTG
REV AGCTGCTGTTATCTATGGGGTC
Nlrp3FWD ATTACCCGCCCGAGAAAGG
REV TCGCAGCAAAGATCCACACAG
Casp1FWD ACAAGGCACGGGACCTATG
REV TCCCAGTCAGTCCTGGAAATG
Il1bFWD GCAACTGTTCCTGAACTCAACT
REV ATCTTTTGGGGTCCGTCAACT
Il18FWD ACTTTGGCCGACTTCACTGT
REV GGGTTCACTGGCACTTTGAT
MbpN/AQIAGEN, PPM04745F
Pmp22N/AQIAGEN, PPM05053F
MpzN/AQIAGEN, PPM41824A
MogN/AQIAGEN, PPM33328B