Table 2.

RT-qPCR Primers for Fosb transcripts and Gapdh for probing mRNA expression

TranscriptForwardReverse
Fosb GTGAGAGATTTGCCAGGGTC AGAGAGAAGCCGTCAGGTTG
ΔFosb AGGCAGAGCTGGAGTCGGAGAT GCCGAGGACTTGAACTTCACTCG
Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
  • These qPCR primers were used to amplify and assess expression of Fosb and ΔFosb mRNA. Gapdh was used as a housekeeping gene in the ΔΔCt method.