Table 1.

Overview of the sequences of the forward and the reverse primers used for qRT-PCR analysis

GeneForwardReverse
HprtAGTGTTGGATACAGGCCAGACCGTGATTCAAATCCCTGAAGT
RplCCTGCTGCTCTCAAGGTTTGGTTGTCACTGCCTCGTACTT
UbcAGGTCAAACAGGAAGACAGACGTATCACACCCAAGAACAAGCACA
GapdhTGAAGCAGGCATCTGAGGGCGAAGGTGGAAGAGTGGGAG
Il1βCACCTCACAAGCAGAGCACAAGGCATTAGAAACAGTCCAGCCCATAC
Il6TAGTCCTTCCTACCCCAATTTCCTTGGTCCTTAGCCACTCCTTC
TnfACCCTGGTATGAGCCCATATACACACCCATTCCCTTCACAGAG
C3CCAGCTCCCCATTAGCTCTGGCACTTGCCTCTTTAGGAAGTC