Key resources
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (Mus musculus) | C57BL/6J | The Jackson Laboratory | Stock #000664 RRID: IMSR_JAX:000664 | |
Cell line | Human Embryonic Kidney 293-6E | Thermo Fisher | Catalog #A14527 | For work done at Grifols and Proteos |
Peptide, recombinant protein | Human TIMP2(1–220) | Grifols Diagnostic Solutions | N/A | |
Peptide, recombinant protein | Human TIMP2(1-220)_human IgG4Fc | Grifols Diagnostic Solutions | N/A | TIMP2-hIgG4 |
Peptide, recombinant protein | Human TIMP2(1–26)_Ala_TIMP2(27–220) | Grifols Diagnostic Solutions | N/A | Ala-TIMP2 |
Peptide, recombinant protein | Recombinant Mouse MMP-2 (carrier-free) | BioLegend | Catalog #554404 | Pro-enzyme Ms-pro-MMP2 |
Peptide, recombinant protein | Recombinant Mouse MMP-3 (carrier-free) | BioLegend | Catalog #552704 | Pro-enzyme Ms-pro-MMP3 |
Peptide, recombinant protein | Recombinant Mouse MMP-9 (carrier-free) | BioLegend | Catalog #755204 | Pro-enzyme Ms-pro-MMP9 |
Peptide, recombinant protein | Recombinant Human MMP-2 (carrier-free, pro-enzyme) | R&D Systems | Catalog #902-MP-010 | Pro-enzyme Hu-pro-MMP2.0 |
Peptide, recombinant protein | Recombinant Human MMP-2 (carrier-free) | BioLegend | Catalog #554304 | Pro-enzyme Hu-pro-MMP2.1 |
Peptide, recombinant protein | Recombinant Human MMP-3 (carrier-free) | BioLegend | Catalog #594704 | Pro-enzyme Hu-pro-MMP3 |
Peptide, recombinant protein | Recombinant Human MMP-9 (carrier-free) | BioLegend | Catalog #550504 | Pro-enzyme Hu-pro-MMP9 |
Peptide, recombinant protein | Recombinant Human MMP-2 (pro-enzyme) | AnaSpec | Catalog #AS-72005 | Pro-enzyme Hu-pro-MMP2.2 |
Peptide, recombinant protein | Recombinant Human MMP-3 (catalytic domain) | AnaSpec | Catalog #AS-72006 | Catalytic domain (active) Hu-CD-MMP3 |
Peptide, recombinant protein | Recombinant Human MMP-9 (catalytic domain) | AnaSpec | Catalog #AS-55576-1 | Catalytic domain (active) Hu-CD-MMP9 |
Antibody | Anti-Doublecortin (guinea pig polyclonal) | Millipore | Catalog #AB2253 RRID: AB_1586992 | IHC 1:2000 |
Antibody | Anti-EGR1, clone 15F7 (rabbit monoclonal) | Cell Signaling Technology | Catalog #4153 RRID: AB_2097038 | IHC 1:2000 |
Antibody | Anti-CD68, clone FA-11 (rat monoclonal) | Bio-Rad | Catalog #MCA1957 RRID: AB_322219 | IHC 1:1000 |
Antibody | Anti-Iba1 (rabbit polyclonal) | FUJIFILM Wako Pure Chemical Corporation | Catalog #019-19741 RRID: AB_839504 | IHC 1:2500 |
Antibody | Anti-Synapsin-1/2 (chicken polyclonal) | Synaptic Systems | Catalog #106006 RRID: AB_262240 | IHC 1:1000 |
Antibody | Anti-PSD-95, clone D27E11 (rabbit monoclonal) | Cell Signaling Technology | Catalog #3450 RRID: AB_2292883 | IHC 1:250 |
Antibody | Anti-Homer1 (rabbit polyclonal) | Synaptic Systems | Catalog #160003 RRID: AB_887730 | IHC 1:500 |
Antibody | Anti-Gephyrin | Synaptic Systems | Catalog #147018 RRID: AB_2651176 | IHC 1:500 |
Antibody | Alexa 555 or 647 secondaries | Invitrogen | IHC 1:300 | |
Antibody | Anti-c-Fos, clone 9F6 (rabbit monoclonal) | Cell Signaling Technology | Catalog #2250 RRID: AB_2247211 | IHC 1:1000 iDISCO 1:1000 |
Antibody | Biotinylated anti-guinea pig IgG (goat) | Vector Laboratories | Catalog #BA-7000 RRID: AB_2336132 | IHC 1:300 |
Other | Hoechst | Invitrogen | Catalog #H3570 | IHC 1:10,000 |
Other | Prolong Gold Antifade Mountant | Invitrogen | Catalog #P36934 | |
Other | Series S Sensor Chip CM5 | Cytiva | Catalog #29149603 | |
Other | Streptavadin Octet Tips | Sartorius | Catalog #18-0009 | SA |
Other | Protein A Octet Tips | Sartorius | Catalog #18–0004 | ProA |
Other | 4–15% Criterion TGX Stain Free Midi Protein Gel, 26-well | Bio-Rad | Catalog #6578085 | |
Other | Hitrap SP Sepharose HP Column | Cytiva | Catalog #17115201 | For work done at Grifols |
Other | SP-Sepharose Fast Flow Resin | Cytiva | Catalog #17072901 | For work done at Proteos |
Other | HiTrap MabSelect SuRe | Cytiva | Catalog #11003495 | For work done at Grifols |
Other | Protein A Praesto AC | Purolite | Catalog #PR00200-310 | For work done at Proteos |
Other | HiLoad 16/600 Superdex 75-pg Size Exclusion Column | Cytiva | Catalog #28989333 | For work done at Grifols |
Other | Superdex 75 Size Exclusion Column | Cytiva | Catalog # dependent on size or quantity ordered | For work done at Proteos |
Other | PEIpro, linear | Polyplus | Catalog #115-01L | For work done at Proteos |
Chemical compound | 3,3′-Diaminobenzidine tetrahydrochloride (DAB) | Sigma-Aldrich | Catalog #D5905 | |
Chemical compound | Citrisolv Clearing Agent | Decon Labs | Catalog #22-143-975 | |
Chemical compound | Cytoseal | Thermo Fisher | Catalog #8310-4 | |
Chemical compound | Tissue Extraction Reagent I | Thermo Fisher | Catalog #FNN0071 | |
Chemical compound, drug | 2,2,2-tribromoethanol (Avertin) | Sigma-Aldrich | Catalog #T48402-25G | 1.61 g/ml stock diluted 1:40 in sterile saline |
Chemical compound | Corning Dulbecco’s PBS (DPBS) | Spectrum Chemical | Catalog #21-030-CM | For dilution of TIMP2 constructs |
Chemical compound | Paraformaldehyde (32% stock) | Electron Microscopy Sciences | Catalog #15714S | 4% working solution made in PBS |
Chemical compound | Sucrose | Fisher Scientific | Catalog #S5-3 | 30% w/v working solution made in PBS |
Chemical compound | Ethylene glycol | Fisher Scientific | Catalog #E178-4 | |
Chemical compound | Glycerol | Sigma-Aldrich | Catalog #G5516 | |
Chemical compound | Ethylenediaminetetraacetic acid (EDTA) | Boston BioProducts | Catalog #BM-711 | |
Chemical compound | HBS-P+, 10× concentrated; 0.1 m HEPES, 1.5 m NaCl, 0.5 v/v Surfactant P20, pH 7.4 | Cytiva | Catalog #BR100671 | |
Chemical compound | BIA normalizing solution (70% glycerol) | Cytiva | Catalog #29207950 | |
Chemical compound | 10 mm glycine-HCl, pH 2.5 | Cytiva | Catalog #BR100356 | Glycine 2.5 |
Chemical compound | 50 mm sodium hydroxide | Cytiva | Catalog #BR100358 | NaOH 50 |
Chemical compound | 10 mm sodium acetate, pH 5.0 | Cytiva | Catalog #BR100351 | Acetate 5.0 |
Chemical compound | Bovine serum albumin, heat shock fraction, suitable for RIA, pH 5.2, ≥96% | Sigma-Aldrich | Catalog #A7888-100g | BSA |
Chemical compound | PBS 20×, pH 7.5, Ultra Pure | VWR | Catalog #E703-1L | For work done at Grifols Diluted to 1× in Milli-Q H2O |
Chemical compound | 10× PBS, pH 7.4 | Corning | Catalog #46-013-CM | For work done at Proteos Diluted to 1× in Milli-Q H2O |
Chemical compound | 100% Polyoxyethyenesorbitan monolaurate | Sigma-Aldrich | Catalog #P-7949 | Tween 20 |
Chemical compound | 1 m Tris-HCl, pH 8.0 | Teknova | Catalog #T1080 | For work done at Grifols |
Chemical compound | 1 m Tris-HCl, pH 8.0 | Corning | Catalog #46-031-CM | For work done at Proteos |
Chemical compound | 5 m NaCl | Quality Biologicalalal | Catalog #351-036-491 | For work done at Grifols Diluted to 1 m in Milli-Q H2O |
Chemical compound | 5 m NaCl | Corning | Catalog #46-032-CV | For work done at Proteos |
Chemical compound | 1 m NaOAc, pH 5.0 | Teknova | Catalog #S0391 | For work done at Grifols Diluted to 2 mm in Milli-Q H2O |
Chemical compound | NaOAc | JT Baker | Catalog #3470 | For work done at Proteos Working stock: 25 mm NaOAc, pH 5.0 |
Chemical compound | EXPI293 Expression Media | Thermo Fisher | Catalog #A1435102 | For work done at Grifols |
Chemical compound | F17 supplemented with 0.1% Pluronic F-68, 4 mm GlutaMAX, 25 μg/ml G418 | Life Technologies | Catalog # dependent on size or quantity ordered | For work done at Proteos |
Commercial assay or kit | Vectastain ABC kit | Vector Laboratories | Catalog #PK-4000 | |
Commercial assay or kit | Mouse TIMP-2 DuoSet ELISA | R&D Systems | Catalog #DY6304 | |
Commercial assay or kit | Human TIMP-2 DuoSet ELISA | R&D Systems | Catalog #DY971 | |
Commercial assay or kit | DuoSet ELISA Ancillary Reagent Kit 2 | R&D Systems | Catalog #DY008 | |
Commercial assay or kit | Mouse MMP2 ELISA kit | Sigma-Aldrich | Catalog #RAB0366 | |
Commercial assay or kit | SensoLyte 520 MMP-2 Assay kit, Fluorimetric | AnaSpec | Catalog #AS-71151 | |
Commercial assay or kit | SensoLyte 520 MMP-3 Assay kit, Fluorimetric | AnaSpec | Catalog #AS-71152 | |
Commercial assay or kit | SensoLyte 520 MMP-9 Assay kit, Fluorimetric | AnaSpec | Catalog #AS-71155 | |
Commercial assay or kit | RNeasy Mini kit | QIAGEN | Catalog #74106 | |
Commercial assay or kit | Superscript III First-Strand Synthesis SuperMix kit | Invitrogen | Catalog #11752050 | |
Commercial assay or kit | Applied Biosystems SYBR Green PCR Master Mix | Thermo Fisher | Catalog #43-091-55 | |
Commercial assay or kit | Applied Biosystems TaqMan Multiplex Master Mix | Thermo Fisher | Catalog #44-842-63 | |
Commercial assay or kit | Amine Coupling kit | Cytiva | Catalog #BR100050 | |
Commercial assay or kit | EZ-Link NHS-PEG4-Biotin, No-Weigh Format Biotinlyation kit | Thermo Fisher | Catalog #A39259 | |
Commercial assay or kit | ExpiFectamine 293 Transfection kit | Thermo Fisher | Catalog #A14525 | |
Sequence-based reagent | Mouse Dcx (DCX) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00438400_m1 | |
Sequence-based reagent | Mouse Tubb3 (β-tubulin III) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00727586_s1 | |
Sequence-based reagent | Mouse Syn1 (Synapsin-1) qPCR primers | Integrated DNA Technologies, Inc | GGAAGGGATCACATTATTGAGG/TGCTTGTCTTCATCCTGGTG | |
Sequence-based reagent | Mouse Dlg4 (PSD-95) qPCR primers | Integrated DNA Technologies, Inc | CGCTACCAAGATGAAGACACG/CAATCACAGGGGGAGAATTG | |
Sequence-based reagent | Mouse Gria1 (GluR1) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00433753_m1 | |
Sequence-based reagent | Mouse Grin2a (GluN2A) qPCR primers | Integrated DNA Technologies, Inc | TGATGAACCGCACTGACCCTA/GGAAGAACGTGGATGTCGGA | |
Sequence-based reagent | Mouse Slc2a1 (vGLUT1) qPCR primers | Integrated DNA Technologies, Inc | CCGGGCCTTGACCTTAGC/CCTCGAGCCGCTGAATTAAT | |
Sequence-based reagent | Mouse Gad1 (GAD1) qPCR primers | Integrated DNA Technologies, Inc | CCTTCGCCTGCAACCTCCTCGAAC/GCGCAGTTTGCTCCTCCCCGTTCTT | |
Sequence-based reagent | Mouse cfos (c-Fos) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00487425_m1 | |
Sequence-based reagent | Mouse Creb1 (CREB1) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00501607_m1 | |
Sequence-based reagent | Mouse Egr1 (EGR1) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00656724_m1 | |
Sequence-based reagent | Mouse Il1a (IL-1α) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00439620_m1 | |
Sequence-based reagent | Mouse Il1b (IL-1β) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00434228_m1 | |
Sequence-based reagent | Mouse Il6 (IL-6) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00446190_m1 | |
Sequence-based reagent | Mouse Ccl11 (Eotaxin) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00441238_m1 | |
Sequence-based reagent | Mouse Nfkb (NFκB) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00476361_m1 | |
Sequence-based reagent | Mouse Tnfa (TNFα) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00443258_m1 | |
Sequence-based reagent | Mouse Cd68 (CD68) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm03047343_m1 | |
Sequence-based reagent | Mouse Iba1 (Iba1) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00479862_g1 | |
Sequence-based reagent | Mouse Cd11b (CD11b) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00434455_m1 | |
Sequence-based reagent | Mouse Aqp4 (AQP4) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm00802131_m1 | |
Sequence-based reagent | Mouse Gfap (GFAP) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm01253033_m1 | |
Sequence-based reagent | Mouse Ggta1 (GGTA1) qPCR primers | Thermo Fisher | Catalog #4331182 Assay ID: Mm01333302_m1 | |
Software, algorithm | ANY-Maze | Stoelting Co | RRID: SCR_014289 | |
Software, algorithm | Zen | Zeiss | Zen Blue 2.5 RRID: SCR_013672 | |
Software, algorithm | Image-Pro | Media Cybernetics, Inc | Image-Pro 9.2 RRID: SCR_016879 | |
Software, algorithm | SynapseCounter (ImageJ plugin) | https://github.com/SynPuCo/SynapseCounter | ||
Software, algorithm | QuantStudio | Applied Biosystems | QuantStudio 6 RRID: SCR_020239 | |
Software, algorithm | GraphPad Prism | GraphPad Software, Inc | GraphPad Prism 8 RRID: SCR_002798 | |
Software, algorithm | Image Lab | Bio-Rad | Image Lab 6.0.1 RRID: SCR_014210 | |
Software, algorithm | Astra | Wyatt Technology | Astra 7.3.2 RRID: SCR_016255 | |
Software, algorithm | Unicorn | Cytiva | Unicorn 7.7 RRID: SCR_019958 | |
Software, algorithm | Octet Analysis Studio | ForteBio/Sartorius | Octet Analysis Studio 12.2.2.26 | |
Software, algorithm | Masshunter Workstation Software | Agilent Technologies | Masshunter 9.0.9044.1 SP1 | |
Software, algorithm | EndoScan-V | Charles River | EndoScan-V version 6.0.2 | |
Software, algorithm | Biacore T200 Control and Evaluation Software | Cytiva | Biacore T200 Software 3.2.1 RRID: SCR_019718 |
Table provides a description of the key resources used and manufacturing product numbers. N/A, not applicable.