Table 2

Key resources

Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Mus musculus)C57BL/6JThe Jackson LaboratoryStock #000664
RRID: IMSR_JAX:000664
Cell lineHuman Embryonic Kidney 293-6EThermo FisherCatalog #A14527For work done at Grifols and Proteos
Peptide, recombinant proteinHuman TIMP2(1–220)Grifols Diagnostic SolutionsN/A
Peptide, recombinant proteinHuman TIMP2(1-220)_human IgG4FcGrifols Diagnostic SolutionsN/ATIMP2-hIgG4
Peptide, recombinant proteinHuman TIMP2(1–26)_Ala_TIMP2(27–220)Grifols Diagnostic SolutionsN/AAla-TIMP2
Peptide, recombinant proteinRecombinant Mouse MMP-2 (carrier-free)BioLegendCatalog #554404Pro-enzyme
Ms-pro-MMP2
Peptide, recombinant proteinRecombinant Mouse MMP-3 (carrier-free)BioLegendCatalog #552704Pro-enzyme
Ms-pro-MMP3
Peptide, recombinant proteinRecombinant Mouse MMP-9 (carrier-free)BioLegendCatalog #755204Pro-enzyme
Ms-pro-MMP9
Peptide, recombinant proteinRecombinant Human MMP-2 (carrier-free, pro-enzyme)R&D SystemsCatalog #902-MP-010Pro-enzyme
Hu-pro-MMP2.0
Peptide, recombinant proteinRecombinant Human MMP-2 (carrier-free)BioLegendCatalog #554304Pro-enzyme
Hu-pro-MMP2.1
Peptide, recombinant proteinRecombinant Human MMP-3 (carrier-free)BioLegendCatalog #594704Pro-enzyme
Hu-pro-MMP3
Peptide, recombinant proteinRecombinant Human MMP-9 (carrier-free)BioLegendCatalog #550504Pro-enzyme
Hu-pro-MMP9
Peptide, recombinant proteinRecombinant Human MMP-2 (pro-enzyme)AnaSpecCatalog #AS-72005Pro-enzyme
Hu-pro-MMP2.2
Peptide, recombinant proteinRecombinant Human MMP-3 (catalytic domain)AnaSpecCatalog #AS-72006Catalytic domain (active)
Hu-CD-MMP3
Peptide, recombinant proteinRecombinant Human MMP-9 (catalytic domain)AnaSpecCatalog #AS-55576-1Catalytic domain (active)
Hu-CD-MMP9
AntibodyAnti-Doublecortin (guinea pig polyclonal)MilliporeCatalog #AB2253
RRID: AB_1586992
IHC 1:2000
AntibodyAnti-EGR1, clone 15F7 (rabbit monoclonal)Cell Signaling TechnologyCatalog #4153
RRID: AB_2097038
IHC 1:2000
AntibodyAnti-CD68, clone FA-11 (rat monoclonal)Bio-RadCatalog #MCA1957
RRID: AB_322219
IHC 1:1000
AntibodyAnti-Iba1 (rabbit polyclonal)FUJIFILM Wako Pure Chemical CorporationCatalog #019-19741
RRID: AB_839504
IHC 1:2500
AntibodyAnti-Synapsin-1/2 (chicken polyclonal)Synaptic SystemsCatalog #106006
RRID: AB_262240
IHC 1:1000
AntibodyAnti-PSD-95, clone D27E11 (rabbit monoclonal)Cell Signaling TechnologyCatalog #3450
RRID: AB_2292883
IHC 1:250
AntibodyAnti-Homer1 (rabbit polyclonal)Synaptic SystemsCatalog #160003
RRID: AB_887730
IHC 1:500
AntibodyAnti-GephyrinSynaptic SystemsCatalog #147018
RRID: AB_2651176
IHC 1:500
AntibodyAlexa 555 or 647 secondariesInvitrogenIHC 1:300
AntibodyAnti-c-Fos, clone 9F6 (rabbit monoclonal)Cell Signaling TechnologyCatalog #2250
RRID: AB_2247211
IHC 1:1000
iDISCO 1:1000
AntibodyBiotinylated anti-guinea pig IgG (goat)Vector LaboratoriesCatalog #BA-7000
RRID: AB_2336132
IHC 1:300
OtherHoechstInvitrogenCatalog #H3570IHC 1:10,000
OtherProlong Gold Antifade MountantInvitrogenCatalog #P36934
OtherSeries S Sensor Chip CM5CytivaCatalog #29149603
OtherStreptavadin Octet TipsSartoriusCatalog #18-0009SA
OtherProtein A Octet TipsSartoriusCatalog #18–0004ProA
Other4–15% Criterion TGX Stain Free Midi Protein Gel, 26-wellBio-RadCatalog #6578085
OtherHitrap SP Sepharose HP ColumnCytivaCatalog #17115201For work done at Grifols
OtherSP-Sepharose Fast Flow ResinCytivaCatalog #17072901For work done at Proteos
OtherHiTrap MabSelect SuReCytivaCatalog #11003495For work done at Grifols
OtherProtein A Praesto ACPuroliteCatalog #PR00200-310For work done at Proteos
OtherHiLoad 16/600 Superdex 75-pg Size Exclusion ColumnCytivaCatalog #28989333For work done at Grifols
OtherSuperdex 75 Size Exclusion ColumnCytivaCatalog # dependent on size or quantity orderedFor work done at Proteos
OtherPEIpro, linearPolyplusCatalog #115-01LFor work done at Proteos
Chemical compound3,3′-Diaminobenzidine tetrahydrochloride (DAB)Sigma-AldrichCatalog #D5905
Chemical compoundCitrisolv Clearing AgentDecon LabsCatalog #22-143-975
Chemical compoundCytosealThermo FisherCatalog #8310-4
Chemical compoundTissue Extraction Reagent IThermo FisherCatalog #FNN0071
Chemical compound, drug2,2,2-tribromoethanol (Avertin)Sigma-AldrichCatalog #T48402-25G1.61 g/ml stock diluted 1:40 in sterile saline
Chemical compoundCorning Dulbecco’s PBS (DPBS)Spectrum ChemicalCatalog #21-030-CMFor dilution of TIMP2 constructs
Chemical compoundParaformaldehyde (32% stock)Electron Microscopy SciencesCatalog #15714S4% working solution made in PBS
Chemical compoundSucroseFisher ScientificCatalog #S5-330% w/v working solution made in PBS
Chemical compoundEthylene glycolFisher ScientificCatalog #E178-4
Chemical compoundGlycerolSigma-AldrichCatalog #G5516
Chemical compoundEthylenediaminetetraacetic acid (EDTA)Boston BioProductsCatalog #BM-711
Chemical compoundHBS-P+, 10× concentrated; 0.1 m HEPES, 1.5 m NaCl, 0.5 v/v Surfactant P20, pH 7.4CytivaCatalog #BR100671
Chemical compoundBIA normalizing solution (70% glycerol)CytivaCatalog #29207950
Chemical compound10 mm glycine-HCl, pH 2.5CytivaCatalog #BR100356Glycine 2.5
Chemical compound50 mm sodium hydroxideCytivaCatalog #BR100358NaOH 50
Chemical compound10 mm sodium acetate, pH 5.0CytivaCatalog #BR100351Acetate 5.0
Chemical compoundBovine serum albumin, heat shock fraction, suitable for RIA, pH 5.2, ≥96%Sigma-AldrichCatalog #A7888-100gBSA
Chemical compoundPBS 20×, pH 7.5, Ultra PureVWRCatalog #E703-1LFor work done at Grifols
Diluted to 1× in Milli-Q H2O
Chemical compound10× PBS, pH 7.4CorningCatalog #46-013-CMFor work done at Proteos
Diluted to 1× in Milli-Q H2O
Chemical compound100% Polyoxyethyenesorbitan monolaurateSigma-AldrichCatalog #P-7949Tween 20
Chemical compound1 m Tris-HCl, pH 8.0TeknovaCatalog #T1080For work done at Grifols
Chemical compound1 m Tris-HCl, pH 8.0CorningCatalog #46-031-CMFor work done at Proteos
Chemical compound5 m NaClQuality BiologicalalalCatalog #351-036-491For work done at Grifols
Diluted to 1 m in Milli-Q H2O
Chemical compound5 m NaClCorningCatalog #46-032-CVFor work done at Proteos
Chemical compound1 m NaOAc, pH 5.0TeknovaCatalog #S0391For work done at Grifols
Diluted to 2 mm in Milli-Q H2O
Chemical compoundNaOAcJT BakerCatalog #3470For work done at Proteos
Working stock: 25 mm NaOAc, pH 5.0
Chemical compoundEXPI293 Expression MediaThermo FisherCatalog #A1435102For work done at Grifols
Chemical compoundF17 supplemented with 0.1% Pluronic F-68, 4 mm GlutaMAX, 25 μg/ml G418Life TechnologiesCatalog # dependent on size or quantity orderedFor work done at Proteos
Commercial assay or kitVectastain ABC kitVector LaboratoriesCatalog #PK-4000
Commercial assay or kitMouse TIMP-2 DuoSet ELISAR&D SystemsCatalog #DY6304
Commercial assay or kitHuman TIMP-2 DuoSet ELISAR&D SystemsCatalog #DY971
Commercial assay or kitDuoSet ELISA Ancillary Reagent Kit 2R&D SystemsCatalog #DY008
Commercial assay or kitMouse MMP2 ELISA kitSigma-AldrichCatalog #RAB0366
Commercial assay or kitSensoLyte 520 MMP-2 Assay kit, FluorimetricAnaSpecCatalog #AS-71151
Commercial assay or kitSensoLyte 520 MMP-3 Assay kit, FluorimetricAnaSpecCatalog #AS-71152
Commercial assay or kitSensoLyte 520 MMP-9 Assay kit, FluorimetricAnaSpecCatalog #AS-71155
Commercial assay or kitRNeasy Mini kitQIAGENCatalog #74106
Commercial assay or kitSuperscript III First-Strand Synthesis SuperMix kitInvitrogenCatalog #11752050
Commercial assay or kitApplied Biosystems SYBR Green PCR Master MixThermo FisherCatalog #43-091-55
Commercial assay or kitApplied Biosystems TaqMan Multiplex Master MixThermo FisherCatalog #44-842-63
Commercial assay or kitAmine Coupling kitCytivaCatalog #BR100050
Commercial assay or kitEZ-Link NHS-PEG4-Biotin, No-Weigh Format Biotinlyation kitThermo FisherCatalog #A39259
Commercial assay or kitExpiFectamine 293 Transfection kitThermo FisherCatalog #A14525
Sequence-based reagentMouse Dcx (DCX) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00438400_m1
Sequence-based reagentMouse Tubb3 (β-tubulin III) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00727586_s1
Sequence-based reagentMouse Syn1 (Synapsin-1) qPCR primersIntegrated DNA Technologies, IncGGAAGGGATCACATTATTGAGG/TGCTTGTCTTCATCCTGGTG
Sequence-based reagentMouse Dlg4 (PSD-95) qPCR primersIntegrated DNA Technologies, IncCGCTACCAAGATGAAGACACG/CAATCACAGGGGGAGAATTG
Sequence-based reagentMouse Gria1 (GluR1) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00433753_m1
Sequence-based reagentMouse Grin2a (GluN2A) qPCR primersIntegrated DNA Technologies, IncTGATGAACCGCACTGACCCTA/GGAAGAACGTGGATGTCGGA
Sequence-based reagentMouse Slc2a1 (vGLUT1) qPCR primersIntegrated DNA Technologies, IncCCGGGCCTTGACCTTAGC/CCTCGAGCCGCTGAATTAAT
Sequence-based reagentMouse Gad1 (GAD1) qPCR primersIntegrated DNA Technologies, IncCCTTCGCCTGCAACCTCCTCGAAC/GCGCAGTTTGCTCCTCCCCGTTCTT
Sequence-based reagentMouse cfos (c-Fos) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00487425_m1
Sequence-based reagentMouse Creb1 (CREB1) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00501607_m1
Sequence-based reagentMouse Egr1 (EGR1) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00656724_m1
Sequence-based reagentMouse Il1a (IL-1α) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00439620_m1
Sequence-based reagentMouse Il1b (IL-1β) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00434228_m1
Sequence-based reagentMouse Il6 (IL-6) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00446190_m1
Sequence-based reagentMouse Ccl11 (Eotaxin) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00441238_m1
Sequence-based reagentMouse Nfkb (NFκB) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00476361_m1
Sequence-based reagentMouse Tnfa (TNFα) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00443258_m1
Sequence-based reagentMouse Cd68 (CD68) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm03047343_m1
Sequence-based reagentMouse Iba1 (Iba1) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00479862_g1
Sequence-based reagentMouse Cd11b (CD11b) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00434455_m1
Sequence-based reagentMouse Aqp4 (AQP4) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm00802131_m1
Sequence-based reagentMouse Gfap (GFAP) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm01253033_m1
Sequence-based reagentMouse Ggta1 (GGTA1) qPCR primersThermo FisherCatalog #4331182
Assay ID: Mm01333302_m1
Software, algorithmANY-MazeStoelting CoRRID: SCR_014289
Software, algorithmZenZeissZen Blue 2.5
RRID: SCR_013672
Software, algorithmImage-ProMedia Cybernetics, IncImage-Pro 9.2
RRID: SCR_016879
Software, algorithmSynapseCounter (ImageJ plugin)https://github.com/SynPuCo/SynapseCounter
Software, algorithmQuantStudioApplied BiosystemsQuantStudio 6
RRID: SCR_020239
Software, algorithmGraphPad PrismGraphPad Software, IncGraphPad Prism 8 RRID: SCR_002798
Software, algorithmImage LabBio-RadImage Lab 6.0.1
RRID: SCR_014210
Software, algorithmAstraWyatt TechnologyAstra 7.3.2
RRID: SCR_016255
Software, algorithmUnicornCytivaUnicorn 7.7
RRID: SCR_019958
Software, algorithmOctet Analysis StudioForteBio/SartoriusOctet Analysis Studio 12.2.2.26
Software, algorithmMasshunter Workstation SoftwareAgilent TechnologiesMasshunter 9.0.9044.1 SP1
Software, algorithmEndoScan-VCharles RiverEndoScan-V version 6.0.2
Software, algorithmBiacore T200 Control and Evaluation SoftwareCytivaBiacore T200 Software 3.2.1
RRID: SCR_019718
  • Table provides a description of the key resources used and manufacturing product numbers. N/A, not applicable.