Table 2

Key resource table

Key resources table
Reagent type or resourceDesignationSource or referenceIdentifiersAdditional information
Sequence-based reagentPrc1 ISH probeAdvanced Cell Diagnostics57712MFISH
Sequence-based reagentAXL ISH probeAdvanced Cell Diagnostics450931MFISH
Sequence-based reagentMFAP2 ISH probeAdvanced Cell Diagnostics445421MFISH
Sequence-based reagentRobo4 ISH probeAdvanced Cell Diagnostics466321MFISH
Sequence-based reagentV-ZIKA-06 ISH probeAdvanced Cell Diagnostics5\ill\5\ill\1MFISH
AntibodyNs2bGenetexGTX133308Anti-rabbit (1:250)
AntibodyCC3Cell Signaling9661-sAnti-rabbit (1:250)
AntibodyKi67BS PharmigenMAB1567Anti-mouse (1:250)
AntibodyPh3Millipore06-570Anti-rabbit (1:300)
AntibodyTbr2Millipore, Santa CruzAB2283, sc-293481Anti-rabbit (1:300), Anti-mouse (1:250)
AntibodySox2Santa Cruzsc-17320Anti-goat (1:250)
AntibodyTuj1Santa Cruzsc-\?\0005Anti-mouse (1:250)
SecondaryGoat anti-rabbitInvitrogenA11008Goat anti-rabbit (1:500)
SecondaryGoat anti-mouseInvitrogenA21050Goat anti-mouse (1:500)
SecondaryDonkey anti-mouseInvitrogenA2202Donkey anti-mouse (1:500)
SecondaryDonkey anti-rabbitInvitrogenA31573Donkey anti-rabbit (1:500)
VectorTbr2 CreTyler et al. (2015)IUE
VectorPrc1 CreAvailable upon requestIUE
VectorMFAP2 CreAvailable upon requestIUE
VectorCAG-StopLightMontana MolecularIUE
VectorCAG-LNL-LYN-GFPAvailable upon requestIUE
Software, algorithmRhttps://www.r-project.orgSCR 001905
Software, algorithmSeurathttps://\ill\.org/seurat/RRID:SCR_007322
Software, algorithmFijihttps://imagej.net/FijiRRID:SCR_002285
Software, algorithmPrismhttps://www.graphpad.com/scientific-software/prism/RRID:SCR_002798
Software, algorithmSigma Plothttps://systatsoftware.com/downloads/download-sigmaplot/
PrimersPrc1 forwardTACCGTTCTCCGTCCCGCTCGAGGGGCAGAGCCG
PrimersPrc1 reverseGCTCTGCCCCTCGAGCGGGACGGAGAACGG
PrimersPrc1 forwardGGCGAATTGGGTACCCTTGGCTTGCTAGGGTGTGA
PrimersPrc1 reverseCCCTAGCAAGCCAAGCGCTATC
PrimersRobo4 forwardGGCGAATTGGGTACCCATGCATTTGGAGTTTCCATGTCCT
PrimersRobo4 reverseGCTCTGCCCCTCGAGGGCTGCTCTCGGCTCC
PrimersMFAP2 forwardGGCGAATTGGGTACCACTCGATCTCCCTTAATCTGCCT
PrimersMFAP2 reverseGGCGAATTGGGTACCACTCGATCTCCCTTAATCTGCCT
PrimersZIKV forwardAARTACACATACCARAACAAAGTGGT
PrimersZIKV reverseTCCRCTCCCYCTYTGGTCTTG