Table 1

List of RNA sequences and primers

Target
gene
Forward sequence (5′ > 3′)Reverse sequence (5′ > 3′)Amplicon
size (bp)
Accession
number
Usage
Iba1AGCCAGAGCAAGGATTTGCAGN/AN/ANM_017196.3Guide RNA
Iba1N/ATACCCTGCAAATCCTTGCTCTGGN/ANM_017196.3Guide RNA
EGFP-Iba1GACAATATGCGCCTGGACAAGTGCTGTACGGTCCACCTTC334 (WT) or
1114 (insert)
N/AGenotyping
CX3CR1TGCTCAGGACCTCACCATGCAAGATGGTCCCAAAGGCCAC117NM_133534.1qPCR
EGFPCCCGACAACCACTACCTGAGGTCCATGCCGAGAGTGATCC117N/AqPCR
GapdhTCCAGTATGACTCTACCCACGCACGACATACTCAGCACCAG149NM_017008.4qPCR
GfapGCGAAGAAAACCGCATCACCTTTGGTGTCCAGGCTGGTTT77NM_017009.2qPCR
Iba1TGGAGTTTGATCTGAATGGCAATGAGCCACTGGACACCTCTCTA126NM_017196.3qPCR
Olig2GAACCCCGAAAGGTGTGGATTTCCGAATGTGAATTCGATTTGAGG106NM_001100557.1qPCR
NesCAGAGAAGCGCTGGAACAGACCACAGCCAGCTGGAACTTA80NM_012987.2qPCR
NeunCGTTCCCACCACTCTCTTGTTAGCCTCCATAAATCTCAGCACC82NM_001134498.2qPCR
  • N/A, Not applicable.