Table 1

Sequences of the qRT-PCR primers

GeneForward primerReverse primer
P4H-TM AGCCAGTGCCAACCTTG AAGCCTGGGATTTCAAAAAG
β-Actin CAATAGTGATGACCTGGCCGT AGAGGGAAATCGTGCGTGAC
PMCA2 AGAGATAGACCACGCAGAGC CTGGGAATCTTCGATCCGGA
PMCA3 GCAGGACGTGACTCTCATCA CACCAGACACATTCCCACAG
PMCA4 CTTAATGGACCTGCGAAAGC ATCTGCAGGGTTCCCAGATA
Orai1 TTACTCCGAGGTGATGAGCC TGGTGGGTAGTCATGGTCTG
Orai2 AGCTACCTGGAACTCGTCAC CAAACAGATGCACGGCTACC
Orai3 CCAACGACTGCACAGATACG GCTTTGGAAGGCTGTTGTGA
STIM1 ACGATGCCAATGGTGATGTG CACCTCATCCACAGTCCAGT
STIM2 CAATCGTGCCACAGTTTCCA GGCAACTTGACACAGACAGG
SEC61A GCTCCTGTGCATTCTTCTCC GGAAGTCAGCCAGGACAGAG
SEC61B CCGTTCTTAGGCATCAGCAT TTCTCTGCCGAACAGTGGAT
SEC61G CGGTTCTCTCCTGAGCTACG TAACCAGCCGAATTGAGTCC
SERCA2A GCTCCATCTGCTTGTCCATG TTTCGGGCCACAAACTTGAG
SERCA2B CTGTGGAGACCCTTGGTTGT CAGAGCACAGATGGTGGCTA
SERCA3 CCACTCTCCTGCATCTCCTC TCCAATCCCTCAGACACACA
SPCA1Quantitect primer assays (QIAGEN: QT00166278, QT01542072, QT01542079)
MCU CGCCAGGAATATGTTTATCCA CTTGTAATGGGTCTCTCAGTCTCTT
MICU1 GAACTAGCTGTGGGCTCTCG GGTGGCAAAATATCGGAAAA
MCUR1
HIF1α
AGCCCTCAGAGCAGAAAATG
GGCGAGAACGAGAAGAAAAA
CCAGCATCTTCTTCTCGTTCA
AAGTGGCAACTGATGAGCAA