Table 1

The primer sequences used in the qPCR validation of MOR knock-down

Gene primer sequences (5’−3’)
OPRM1 FWD TCAAGGCCCTGGATTTCCGTACCC
OPRM1 RVS CGGGCAGACCAATGGCAGAAGAGA
DRD1 FWD CTTGTCTGTGCCGCTGTCATCAGG
DRD1 RVS GGCATGACCAAGACAGCCACCAAG
DRD2 FWD TTGTTCTTGGTGTGTTCATC
DRD2 RVS TATAGATGATGGGGTTCACG
ACTB FWD TGTGCACTTTTATTGGTCTC
ACTB RVS GATGTATGAAGGCTTTGGTC
  • OPRM1; μ-opioid receptor, DRD1; dopamine 1 receptor, DRD2; dopamine 2 receptor, ACTB; β-actin control, FWD; forward, RVS; reverse.