Table 1

Primer sequences for qPCR or to create probes for in situ hybridization

TestGeneReferencePrimerPrimer sequences (5′–3’)
mRNA in situ
hybridization
dmrt1aAY157562.1F
R
GGCCACAAACGCTTCTGTAA
TTGTAACTGGCAGCTGGAGA
dmrt2aNM_130952.1F
R
ATCCACCCAGTCCAACTCAG
TTCCTCCAGCAGCTCCTTAC
dmrt3aNM_001005779.2F
R
CTCTGGCACCTTTGGAAACC
TTGTGGGCAGGGAAGATCTT
wt1aNM_131046.1F
R
TGACCCAACTTGACTTTGCG
CTGGAGGAGGAACGGGATAC
qPCRdmrt1aAY157562.1F
R
GCCAGTGTCAGAAATGCAGA
TGAACCGGAAAGGTTAATCG
dmrt2aNM_130952.1F
R
CCCGCGATTTGTAATGTGGC
GAGGGTGACTTTCGGTGGAG
dmrt3aNM_001005779.2F
R
TGGCAGTGACAGAGAACCAG
GGGTCAGAGCAGGATTTTGA
wt1aNM_131046.1F
R
GGAAGTCAAGCTCTGCTGCT
AACCTCCTGGATGGCTCTTT
elfaAY422992F
R
CTTCTCAGGCTGACTGTGC
CCGCTAGCATTACCCTCC
rpl13NM_212784F
R
TCTGGAGGACTGTAAGAGGTATGC
AGACGCACAATCTTGAGAGCAG
  • F, Forward; R, reverse.