Table 1

Primers used for cloning

NameSequenceTemplate
Cx36-EGFP and GCaMP cloning
T7 extended GTAATACGACTCACTATAGGGCGAA MsCx36 cDNA
JOB 284 CCAAACTTGGGTACCCACACATAGGC MsCx36 cDNA
JOB 285 CCAAACCTTTGATCACACACATAGGC MsCx36 cDNA
PB513B-1 modification
KBM 1AATTAATGACCTGCAGGTCGACGACTGCATAGGGTTACpIRES DsRedT3-KR24
KBM 2GCCGGGATTCTCCTCCACGATCCATTATCATCGTGTTTTTCAApIRES DsRedT3-KR24
KBM 3 CGCGCCCGCCGCCCTA PB513B-1
KBM 4TGCAGGTCATTAATTAAGGTGGCGTCTAGCGTAGGCGPB513B-1
Cx36-GCaMP – NR1 dual vector cloning
KBM 7 AGCGAATTCGAATTTCAGCGATGGGGGAATGG Cx36-GCaMP
KBM 8 CCGCGGATCCGATTTTACGCCTTAAGATACATTGATGAGTT Cx36-GCaMP
KBM 405 AGACGCCACCTTAATTAACGGAGCTCATGAGCACCATG NR1
KBM 406 ATGCAGTCGTCGACCTGCAGGTCCTCAGCTCTCCCTATGACGG NR1
NR2 cloning
KBM 11 GCTAGCGAATTCGAATTTCTCTCCACAGGTGTCCACTCC NR2C
KBM 12 CGGCCGCGGATCCGATTTGGTGCTGCGCCGAATTA NR2C
KBM 13 GCTAGCGAATTCGAATTTGCTAGCGGCAGATTGGG NR2A
KBM 14 CGGCCGCGGATCCGATTTCCAGCTGGTTCTTTCCGC NR2A
KBM 15 GCTAGCGAATTCGAATTTGTGGTGGGCTGAAGACTCCTTA NR2B
KBM 16 CGGCCGCGGATCCGATTTCCATAGAGCCCACCGCATC NR2B