Table 1.

RT-qPCR primer sets

GeneForward primerReverse primer
Gapdh ACCTTTGATGCTGGGGCTGGC GGGCTGAGTTGGGATGGGGACT
Fos CAGCCTTTCCTACTACCATTCC ACAGATCTGCGCAAAAGTCC
Egr1 TCCTCAAGGGGAGCCGAGCG GGTGATGGGAGGCAACCGGG
Fosb TGCAGCTAAATGCAGAAACC CTCTTCGAGCTGATCCGTTT
Arc GCTGAAGCAGCAGACCTGA TTCACTGGTATGAATCACTGCT
Bdnf IV GCTGCCTTGATGTTTACTTTGA GCAACCGAAGTATGAAATAACC
Per2 CACCCTGAAAAGAAAGTGCGA CAACGCCAAGGAGCTCAAGT
Cry1 AAGTCATCGTGCGCATTTCA TCATCATGGTCGTCGGACAGA
Cry2 GGATAAGCACTTGGAACGGAA ACAAGTCCCACAGGCGGT
Clock TCTCTTCCAAACCAGACGCC TGCGGCATACTGGATGGAAT
Bmal1 CCGATGACGAACTGAAACACCT TGCAGTGTCCGAGGAAGATAGC
  • RT-qPCR primer sets used in the experiments detailed in this article.