Table 1.

Primer sequences of the primers used for qPCR

Gene nameForward primer sequenceReverse primer sequence
Blbp GGACACAATGCACATTCAAGAAC CCGAACCACAGACTTACAGTTT
Cyp1a1 CGTTATGACCATGATGACCAAGA TCCCCAAACTCATTGCTCAGAT
Dcx CCTTGATGGAAAGCAGGTCAC GGCCTGGGCTTTTAGCAGAT
Gfap CAGATCCGAGGGGGCAAAAG TGGCAGGGCTCCATTTTCAA
Glast1 ACCAAAAGCAACGGAGAAGAG GGCATTCCGAAACAGGTAACTC
Nestin CCCTGAAGTCGAGGAGCTG CTGCTGCACCTCTAAGCGA
Nfh GCCGCTTACAGAAAGCTCCT ATGTGCGTGGATATGGAGGG
Ng2 GGGCTGTGCTGTCTGTTGA TGATTCCCTTCAGGTAAGGCA
Olig1 TCTTCCACCGCATCCCTTCT CCGAGTAGGGTAGGATAACTTCG
Pax6 TACCAGTGTCTACCAGCCAAT TGCACGAGTATGAGGAGGTCT
Pdgfr AGAGTTACACGTTTGAGCTGTC GTCCCTCCACGGTACTCCT
Sox2 ACAGAGAAAACCTGAGGGCG GAAGCGCCTAACGTACCACT
TBP GCACAGGAGCCAAGAGTGAA TAGCTGGGAAGCCCAACTTC
Tiparp ACATCACACCGTATTGCCCT GCCCAAAAGTCTTGTCCTCCAT
Tubb3 TGAGGCCTCCTCTCACAAGTA CCGCACGACATCTAGGACTG