Table 1:

Primer designs

β-Actin CAGCCTTCCTTCCTGGGTATGGAATC
  CAGCACTGTGTTGGCATAGAGGTCTTTAC
COX2 TGGTGCCGGGTCTGATGATG
  GCAATGCGGTTCTGATACTG
IL-1β GTGAAATAGCAGCTTTCGACAGTGAGGAG
GTGAGATTTGAAGCTGGATGCTCTCATCTG
IL-1R1 GCTTGTGACATCTTCGGCTA
  AATGAACCCAAGTAGCACTTTCA