Table 2.

qRT-PCR human primer sequences

GenePrimer forward 5´-3´Primer reverse 5´-3´
Ppp1r1b CACACCACCTTCGCTGAAA GAAGCTCCCCCAGCTCAT
Oprm1 AGAAACAGCAGGAGCTGTGG ACCGAGACTTTTCGGGTTC
Calb2 GAAAATCGAGATGGCAGAGC CATAAACTCGGCGCTGGA
Calb1 CACAGCCTCACAGTTTTTCG CCTTTCCTTCCAGGTAACCA
Bcl11b CCCAGAGGGAGCTCATCAC GACACTGGCCACAGGTGAG
ACTB CCAACCGCGAGAAGATGA TCCATCACGATGCCAGTG