Table 1.

qRT-PCR primers sequence

GenePrimer forward 5´-3´Primer reverse 5´-3´
Adcy5 GGCAGCTGGAAAAGATCAAG CCAGCCACTACAGGTCCAAT
Calb 1 ACTCTCAAACTAGCCGCTGCA TCAGCGTCGAAATGAAGCC
Rasgrp1 GGACCTACCAAGAACTGGAA C GATCCCAGTAAACCCGTCTG
Ppp1r1b GAAGAAGAAGACAGCCAGGC TAGTGTTGCTCTGCCTTCCA
Drd1 TTCTTCCTGGTATGGCTTGG GCTTAGCCCTCACGTTCTTG
Drd2 TGGACTCAACAACACAGACCAGAATG GATATAGACCAGCAGGTTGACGATGA
GAPDH AACGACCCCTTCATTGACCT TGGAAGATGGTGATGGGCTT
Foxp2 AAGCAGCTTGCCTTTGCTAAG GGATTGAATGTATGTGTGGCTGA
Oprm1 CCCTCTATTCTATCGTGTGTGT AGAAGAGAGGATCCAGTTGCA
Ppp1cc CATCGACAGCATCATCCAAC GGAAAGCCACCGTATTCAAA
Nr4a1 ATGCCTCCCCTACCAATCTTC CACCAGTTCCTGGAACTTGGA
Nr4a2 CAGCTCGAGCCACATAAACA TCCTTGTCCGCTCTCTTCAT
Ptpn5 CTCTGGACCCTTTCTTGCTG GGATCTTCAGGGTCTGGTGA