Table 1.

G0 founder screening primers

Primer targetLineForward sequenceReverse sequence
iCre internalA2a-Cre; D1-Cre AATGTGAACATTGTGATGAACTACA CAGAATAGAATGACACCTACTCAGACA
insertion spanning
5' junction
A2a-Cre AGGCAACTTTCTAGTTGACAAATCAAG CAGCAGGCTGAAGTTAGTAGCTC
insertion spanning
3' junction
A2a-Cre CATTGTCTGAGTAGGTGTCATTCTATTCT GAATCACAGCCCAAGAGATACTACACT
insertion spanning
5' junction
D1-Cre AAAAGTGACTAGAATTGACCTGGAAGAG AGCAGGTTGGAGACTTTCCTCTTCTTCTT
insertion spanning
3' junction
D1-Cre CATTGTCTGAGTAGGTGTCATTCTATTCT GGAAAAGGAAAGAGAAGCAGAATAAT