Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT

User menu

Search

  • Advanced search
eNeuro
eNeuro

Advanced Search

 

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT
PreviousNext
Research ArticleResearch Article: New Research, Disorders of the Nervous System

341 Repeats Is Not Enough for Methylation in a New Fragile X Mouse Model

Steven Colvin, Nick Lea, Qiangge Zhang, Martin Wienisch, Tobias Kaiser, Tomomi Aida and Guoping Feng
eNeuro 17 August 2022, 9 (5) ENEURO.0142-22.2022; https://doi.org/10.1523/ENEURO.0142-22.2022
Steven Colvin
1Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
2Department of Brain and Cognitive Sciences, McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Steven Colvin
Nick Lea
2Department of Brain and Cognitive Sciences, McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Qiangge Zhang
2Department of Brain and Cognitive Sciences, McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Martin Wienisch
2Department of Brain and Cognitive Sciences, McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tobias Kaiser
2Department of Brain and Cognitive Sciences, McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tomomi Aida
2Department of Brain and Cognitive Sciences, McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Guoping Feng
2Department of Brain and Cognitive Sciences, McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
3Stanley Center for Psychiatric Research, Broad Institute of MIT and Harvard, Cambridge, Massachusetts 02142
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Guoping Feng
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Extended Data
  • Figure 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1.

    FMRhs341 design and validation. A, Sequence alignmnt. Annotated comparison between Mus musculus (M.m.) and Homo sapiens (H.s.) of the region surrounding the fragile X repeat tract. The repeat tract is highlighted in orange, with the # symbol representing variable CGG repeat length sizes in the human population. Guide RNA sequences and their associated PAM (Protospacer Adjacent Motif) sequence are indicated by their position above the M.m. sequence, with the SNPs incorporated by the template to prevent recutting shown in red (note: Cas9 cuts several nucleotides before the PAM sequence). The green box denotes the coding region of exon 1. Sequences are written 5′ to 3′. B, Illustration of knock-in strategy. Embryos are injected with a mixture containing a single-stranded DNA template generated from human patient DNA, Cas9 protein, and two single-guide RNAs flanking the FMR1 CGG repeat tract. The mouse embryo DNA is cut by Cas9 and repaired through homologous recombination with the patient mutation template. The exchange is irreversible because of SNPs in the corresponding guide sequence on the human allele. Purple, 5′ UTR; blue, CGG repeat tract of mouse; red, CGG repeat tract of human expansion; green, coding region of exon 1. C, Confirmation of repeat size by gel electrophoresis. The FMR1hs341 amplicon was predicted to be 1353 bp in length: 190 bp upstream, 1023 bp repeat tract (341 * 3), and 140 bp downstream. Lane 1 provides a DNA ladder (1 kb Plus DNA Ladder; catalog #N3200L, New England BioLabs), lanes 3 and 5 were identified as wild type, lane 7 was identified as FMR1hs341. D, E, Sanger sequencing of upstream and downstream regions, respectively. Red box denotes guide RNA recognition sequence; blue box denotes PAM sequence. The upstream region shows strong incorporation of the human template including several SNPs located 14 bp before the predicted cut site. Upstream sequencing penetrated up to 59 CGG repeats. The downstream region demonstrates precise integration of the human template, and sequencing penetrated up to 74 CGG repeats. Two nucleotides were manually annotated for the downstream sequence. Off-target traces can be found in Extended Data Figure 1-1.

  • Figure 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2.

    FMRhs341 does not exhibit methylation. Bisulfite sequencing of male mouse DNA. Each row represents a single animal, and each circle represents one of the 13 CG cytosines within the sequencing region. Open circle, unmethylated; closed circle, methylated; split circle, partial methylation across multiple reads; no circle, missing in reads. All animals are referenced by F<litter>.<pup>. A, Bisulfite sequencing of wild-type littermates. B, Bisulfite sequencing of Fmr1hs341 littermates. C, Bisulfite sequencing of unrelated C57BL/6 mice. D, Bisulfite sequencing of artificially methylated C57BL/6 mice, which served as a positive control that our methodology could detect methylated cytosines. Sequence traces can be found in Extended Data Figure 2-1.

  • Figure 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3.

    FMRhs341 exhibits premutation molecular pathologies. All animals are referenced by F<litter>.<pup>. A, qRT-PCR quantification. Fmr1 mRNA is consistently higher in Fmr1hs341 male mice (red) compared with their wild-type (blue) male sibling counterparts. Values are normalized to Gapdh and Actin expression across each brain region and presented as the mean ± SEM. fCORTEX, Frontal cortex; pCORTEX, posterior cortex. B, Western blot quantification. FMRP is drastically reduced in Fmr1hs341 (red) mice compared with wild-type (blue) siblings. Values are normalized to wild-type GAPDPH expression levels.

Tables

  • Figures
  • Extended Data
    • View popup
    Table 1

    Off-Target primers: primers for amplifying and sequencing candidate off-target sites

    Off-target
    site
    GuideChromosomeGeneMismatchForward primerReverse primerSequencing primer
    1Upstream9Trank13AGGGCCCTTAGCATTTTTGCAGCCAGCTGCAAGGAAACTCGGATGTCTCCCTCTATGCAGTG
    2Upstream73GTACTGTCTTGGTGAGGGATTGCCCAACAGAAGGCAGAGTAAGCTCATACCATACCGTGCAG
    3Upstream13CAGAGGCAGGTGGATTTCTAAGCGGTTCTAGGATTGCTGTTCTCTTCTCCATCACCATGCTGTG
    4Upstream183AGTTGCATCTCACAGTTCCTATCCTATGGGCCGGCTTCTATTATGGTAAGCTGATCTCTCCGATC
    5Upstream123GAATACAGAGCTGAGGGAATGGGGAGAACATGAGAGCTGGATATGCAGTAGTAGAGCCATCCTTAC
    6Upstream173GATTATCAGCAGGGCTAGGATGAGAGAGCATTGTGGGAATGAGCCTTTAGCTCTGGGAGGTTTC
    7Upstream53GGTTCAGTTGCTTCCCAGTTCCCGAAAGCTTGATCGAAGAGCTGAGGATCTAGAAGCACTG
    8Upstream73TTCTGTACGGTTGGCTTCTTCGGTGAGTCATCTCAGCAATCTCACTTCAGGAGTCTTCTCTC
    9Upstream9Mcam3TGAGGGTAAGGAGAGGGTAAGGTACCATAGGACTTGAGGAATGGGTCGCTTGCTCTTACACAG
    10Upstream4Ctnnbip14TGCCTCAGCCGGAAATAAGACACAGACACACAGACACATAGCTAGGGTCTCAAGCCTTC
    11Downstream73CCACCTTACACTAGCCATGAACCAAGGGCAGGATTGGAAGATACAGAGACACAGAGGGACAAG
    12Downstream73CCACCTTACACTAGCCATGAACCAAGGGCAGGATTGGAAGATACAGAGACACAGAGGGACAAG
    • View popup
    Table 2

    Statistical table for behavioral experiments

    ExperimentData structureType of test95% CI
    a Rotarod day 1Small N (nonparametric)Kruskal–Wallis−66.7, 34.0
    b Rotarod day 2Small N (nonparametric)Kruskal–Wallis−40.0, 75.7
    c Rotarod day 3Small N (nonparametric)Kruskal–Wallis−23.0, 90.0
    d Open field distanceSmall N (nonparametric)Kruskal–Wallis−1364.0, 962.0
    e Zero plus distanceSmall N (nonparametric)Kruskal–Wallis−1010.2, 1600.7
    • Graphical representations of results can be found in Extended Data Table 2-1.

Extended Data

  • Figures
  • Tables
  • Figure 1-1

    Off-target sequencing. A–K. Sequence traces of candidate off-target sites 1-12, respectively (note: off-target sites 11 and 12 are both found in K). Matching off-target sequence is highlighted in blue. The Fmr1hs341 F1 generation displays no sign of any off-target cutting. Download Figure 1-1, TIF file.

  • Figure 2-1

    Bisulfite sequencing traces. Representative sequence traces of bisulfite analysis. Sequences are aligned to the wild-type sequence where potentially protected cytosines are denoted with an uppercase C. A, Wild-type sibling F88.6 shows no sign of methylation. B, Fmr1hs341 F80.17 shows no sign of methylation. C, Wild-type mouse control shows no sign of methylation. D, Artificially methylated mouse DNA (2 h incubation) demonstrates successful methylation. Download Figure 2-1, TIF file.

  • Table 2-1

    FMRhs341 does not appear to cause motor deficits. Estimation statistics for behavioral data. All mice were males between 12 and 15 months of age, and age-matched controls were used whenever wildtype siblings were not available. Rightmost data point (FM, full mutation minus NM, no mutation or ∆) represents difference in the medians for effect size. Weighted vertical line indicates 95% confidence interval. Filled curve reflects sampling-error distribution. Generated through Ho et al., 2019 (available at https://www.estimationstats.com/ at time of publication). NM (blue): wildtype; FM (orange): Fmr1hs341. A–C. Time to first fall on the rotarod for mice across three consecutive days compared to wildtype littermates (p-values for: day 1 = 0.252; day 2 = 0.594; day 3 = 0.239) [NM: N = 11; FM: N = 9]. D. Total distance traveled in the open field arena compared to wildtype littermates (p-value = 0.342) [NM: N = 11; FM: N = 9]. E. Total distance traveled in the elevated zero maze apparatus compared to wildtype littermates (p-value = 0.540) [NM: N = 10; FM: N = 5]. Download Table 2-1, TIF file.

Back to top

In this issue

eneuro: 9 (5)
eNeuro
Vol. 9, Issue 5
September/October 2022
  • Table of Contents
  • Index by author
  • Ed Board (PDF)
Email

Thank you for sharing this eNeuro article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
341 Repeats Is Not Enough for Methylation in a New Fragile X Mouse Model
(Your Name) has forwarded a page to you from eNeuro
(Your Name) thought you would be interested in this article in eNeuro.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
341 Repeats Is Not Enough for Methylation in a New Fragile X Mouse Model
Steven Colvin, Nick Lea, Qiangge Zhang, Martin Wienisch, Tobias Kaiser, Tomomi Aida, Guoping Feng
eNeuro 17 August 2022, 9 (5) ENEURO.0142-22.2022; DOI: 10.1523/ENEURO.0142-22.2022

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Share
341 Repeats Is Not Enough for Methylation in a New Fragile X Mouse Model
Steven Colvin, Nick Lea, Qiangge Zhang, Martin Wienisch, Tobias Kaiser, Tomomi Aida, Guoping Feng
eNeuro 17 August 2022, 9 (5) ENEURO.0142-22.2022; DOI: 10.1523/ENEURO.0142-22.2022
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
    • Synthesis
    • Author Response
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

Research Article: New Research

  • Aperiodicity in mouse CA1 and DG power spectra
  • Transcriptional Changes Fade Prior to Long-Term Memory for Sensitization of the Aplysia Siphon-Withdrawal Reflex.
  • Numbers of granule cells and GABAergic boutons are correlated in shrunken sclerotic hippocampi of sea lions with temporal lobe epilepsy
Show more Research Article: New Research

Disorders of the Nervous System

  • Numbers of granule cells and GABAergic boutons are correlated in shrunken sclerotic hippocampi of sea lions with temporal lobe epilepsy
  • Investigating the Role of Cortical Microglia in a Mouse Model of Viral Infection-Induced Seizures
  • Functional-Structural Coupling: Brain Reorganization in Presbycusis Is Related to Cognitive Impairment
Show more Disorders of the Nervous System

Subjects

  • Disorders of the Nervous System
  • Home
  • Alerts
  • Follow SFN on BlueSky
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Latest Articles
  • Issue Archive
  • Blog
  • Browse by Topic

Information

  • For Authors
  • For the Media

About

  • About the Journal
  • Editorial Board
  • Privacy Notice
  • Contact
  • Feedback
(eNeuro logo)
(SfN logo)

Copyright © 2026 by the Society for Neuroscience.
eNeuro eISSN: 2373-2822

The ideas and opinions expressed in eNeuro do not necessarily reflect those of SfN or the eNeuro Editorial Board. Publication of an advertisement or other product mention in eNeuro should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in eNeuro.