Article Figures & Data
Figures
- Figure 1.
Expressions of miR-132-3p and GLRX in the midbrain tissues of patients with PD. The expression of miR-132-3p in the midbrain tissues of five PD patients and five age-matched controls was detected by qRT-PCR (A), and the mRNA and protein expressions of GLRX were measured by qRT-PCR (B), and Western blotting (C); N (number of participants) = 5, *p < 0.05, **p < 0.01, Error bars, standard deviation (SD).
- Figure 2.
LPS-induced inflammatory response in BV-2 microglial cells can be attenuated by miR-132-3p knock-down. Following transfection with miR-132-3p inhibitor or inhibitor NC, BV-2 cells were treated with 0.1 μg/ml LPS or PBS for 24 h. qRT-PCR was used to detect the expression of miR-132-3p in BV-2 cells (A). The mRNA expressions of inflammatory cytokines TNF-α, IL-1β, and IL-6 were analyzed by qRT-PCR (B), and the contents of TNF-α, IL-1β, and IL-6 in the supernatant of BV-2 cells were determined by ELISA (C); N (number of independent cell culture preparations) = 3, **p < 0.01, ***p < 0.001, Error bars, standard deviation (SD).
- Figure 3.
Overexpression of miR-132-3p promotes the release of proinflammatory cytokines in BV-2 microglial cells. After BV-2 cells transfected with miR-132-3p mimic or mimic NC, the mRNA expression of miR-132-3p in BV-2 cells (A) and the mRNA expressions of inflammatory cytokines TNF-α, IL-1β, and IL-6 in BV-2 cells were examined by qRT-PCR (B). Then, ELISA was utilized to assess the contents of TNF-α, IL-1β, and IL-6 in the supernatant of BV-2 cells (C); N (number of independent cell culture preparations) = 3, **p < 0.01, ***p < 0.001, Error bars, standard deviation (SD).
- Figure 4.
Effect of miR-132-3p induced microglial activation on neuronal injury. The SH-SY5Y cells were cultured in the conditioned medium of BV-2 cells that were transfected with inhibitor NC or miR-132-3p inhibitor and stimulated with LPS. Then, CCK-8 assay was used to detect the viability of SH-SY5Y cells (A) and flow cytometry to determine the apoptotic rate (B). Additionally, SH-SY5Y cells were cultured in the conditioned medium of BV-2 cells that transfected with miR-132-3p mimic or mimic NC. The viability of SH-SY5Y cells was assessed by CCK-8 assay (C) and the apoptotic rate of SH-SY5Y cells was measured by flow cytometry (D); N (number of independent cell culture preparations) = 3, *p < 0.05, **p < 0.01, ***p < 0.001, Error bars, standard deviation (SD).
- Figure 5.
MiR-132-3p negatively mediates GLRX. qRT-PCR (A) and Western blotting (B) were used to detect the mRNA and protein expressions of GLRX after miR-132-3p knock-down or overexpression in BV-2 cells. RIP experiment was applied to verify the binding of miR-132-3p to GLRX mRNA (C). After LPS or PBS treatment, RIP was applied to detect the GLRX mRNA expression in Ago2 complex (D). The binding site of miR-132-3p to the 3′-UTR of GLRX mRNA was predicted by StarBase (E). Dual-luciferase reporter assay was utilized to verify the binding relationship between miR-132-3p and GLRX (F); N (number of independent cell culture preparations) = 3, *p < 0.05, **p < 0.01, ***p < 0.001, Error bars, standard deviation (SD).
- Figure 6.
GLRX reverses microglial activation and neuronal injury induced by miR-132-3p. The BV-2 cells were transfected miR-132-3p mimic or cotransfected miR-132-3p mimic and GLRX overexpressing plasmid. Then, qRT-PCR (A) and Western blotting (B) were used to detect the mRNA and protein expressions of GLRX in BV-2 cells. The mRNA expressions of inflammatory cytokines TNF-α, IL-1β, and IL-6 in BV-2 cells were examined by qRT-PCR (C). Then, ELISA was utilized to assess the contents of TNF-α, IL-1β, and IL-6 in the supernatant of BV-2 cells (D). The SH-SY5Y cells were cultured in conditioned medium, in which BV-2 cells were transfected with miR-132-3p mimic or cotransfected miR-132-3p mimic and GLRX overexpressing plasmid. Then, CCK-8 assay was used to detect the viability of SH-SY5Y cells (E) and flow cytometry to determine the apoptotic rate (F); N (number of independent cell culture preparations) = 3, *p < 0.05, **p < 0.01, ***p < 0.001, Error bars, standard deviation (SD).
- Figure 7.
Knock-down of miR-132-3p ameliorates the neuroinflammation and dopaminergic neuron degeneration of PD mouse. Mice were intraperitoneally injected with 30 mg/kg MPTP to establish PD mouse models. Then, mouse models of PD were given stereotactic injection of miR-132-3p antagomir or antagomir NC. FISH was used to examine the expression of miR-132-3p in SNc of mice (A). The expression of GLRX in the SNc of mice was measured by immunohistochemistry (B). FISH was applied to detect the expression of miR-132-3p in microglial cells (C). Immunofluorescence was applied to detect the expression of GLRX in microglial cells (D); Immunofluorescence of Iba1 was applied to detect the activation of microglial cells (E), qRT-PCR to detect the mRNA expressions of TNF-α, IL-1β, and IL-6 in brain tissues of mouse (F), and immunofluorescence of tyrosine hydroxylase to detect the loss of dopaminergic neurons in the SNc of mice (G). The motor ability of mice was assessed after rotarod test and open field test (H); N (number of animals) = 6, *p < 0.05, **p < 0.01, ***p < 0.001, Error bars, standard deviation (SD).
Tables
Name of primer Sequences U6-F CTCGCTTCGGCAGCACA U6-R AACGCTTCACGAATTTGCGT miR-132-3p -F GCAACGTAACAGTCTACAGCC miR-132-3p -R CCAGTGCAGGGTCCGAGGTA β-Actin-F TGTACCCAGGCATTGCTGAC β-Actin-R AACGCAGCTCAGTAACAGTCC GLRX-F AGTTATAAAAGGGGTGGCAGAGT GLRX-R CCCCATGGTTAGGGGCAAAT TNF-α-F AGGCACTCCCCCAAAAGATG TNF-α-R CCACTTGGTGGTTTGTGAGTG IL-1β-F TGCCACCTTTTGACAGTGATG IL-1β-R AAGGTCCACGGGAAAGACAC IL-6-F CAACGATGATGCACTTGCAGA IL-6-R TGTGACTCCAGCTTATCTCTTGG F: forward primer; R: reverse primer.
Abbreviations Full names PD Parkinson’s disease GLRX Glutaredoxin LPS Lipopolysaccharide qRT-RCR Quantitative real-time polymerase chain reaction ELISA Enzyme-linked immunosorbent assay RIP RNA immunoprecipitation MPTP 1-Methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine SNc Substantia nigra compacta TH Tyrosine hydroxylase DMEM Dulbecco’s modified eagle medium PBS Pphosphate buffer Ago2 Argonaute 2 FBS Fetal bovine serum FITC Fluorescein isothiocyanate PI Propidium iodide FISH Fluorescence in situ hybridization RRID Research Resource Identifier NC negative control Names RRIDs or catalog number BV-2 cell YB-ATCC-4255, ATCC SH-SY5Y cell RRID:CVCL_0019 HEK293T cell RRID:CVCL_0063 DMEM 11054001, Gibco DMEM/F12 11330107, Gibco FBS 16140, Invitrogen Penicillin/streptomycin 15140148, Invitrogen LPS L-4391, Sigma-Aldrich Lipofectamine 3000 L3000150, Invitrogen TRIzol 15596026, Invitrogen Reverse transcription kit 6210A, TaKaRa SYBR Green Mix 2015099, Roche RIPA lysis buffer P0013C, Beyotime BCA kit P0012, Beyotime Protein loading buffer P0015A, Beyotime β-Actin antibody RRID:AB_306371 GLRX antibody RRID:AB_880242 Film development kit P0019, Beyotime TNF-α DY410, R&D IL-1β SMLB00C, R&D IL-6 SM6000B, R&D CCK-8 kit CK04, Dojindo Annexin V-FITC cell apoptosis kit C1062L, Beyotime PBS C0221A, Beyotime A + G beads P2108, Beyotime Ago2 antibody RRID:AB_867543 IgG antibody RRID:AB_2687931 pGL3-Promoter E1761, Promega pRL-TK E2241, Promega Dual-Luciferase Reporter Assay System E1910, Promega MPTP M0896, Sigma-Aldrich 4% paraformaldehyde P0099, Beyotime Proteinase K ST535, Beyotime Tyrosine hydroxylase antibody RRID:AB_2801410 Iba1 antibody RRID:AB_2636859 DAPI C1002, Beyotime MiRNA mimic B02003, GenePharma MiRNA inhibitor B03001, GenePharma Gene overexpression plasmid C05001, GenePharma MiRNA antagomir B05001, GenePharma Figure reported N Normal
distributionStatistic Statistic value
(df)p value Variance
sourcePost hoc
testPost hoc p 1A, PD vs control 5 Yes Unpaired t test t(8) = 2.644 0.0295 Difference 1B, PD vs control 5 Yes Unpaired t test t(8) = 3.418 0.0091 Difference 1C, PD vs control 5 Yes Unpaired t test t(8) = 2.449 0.0400 Difference 2A 3 Yes One-way ANOVA F(3,8) = 41.01 <0.0001 Treatment 2A, PBS vs LPS 3 Yes Tukey 0.0025 2A, LPS+inhibitor NC vs LPS+ miR-132-3p inhibitor 3 Yes Tukey <0.0001 2B, TNF-α 3 Yes One-way ANOVA F(3,8) = 62.48 <0.0001 Treatment 2B, TNF-α, PBS vs LPS 3 Yes Tukey <0.0001 2B, TNF-α, LPS+ inhibitor NC vs LPS +miR-132-3p inhibitor 3 Yes Tukey 0.001 2B, IL-1β 3 Yes One-way ANOVA F(3,8) = 68.03 <0.0001 Treatment 2B, IL-1β, PBS vs LPS 3 Yes Tukey <0.0001 2B, IL-1β, LPS+ inhibitor NC vs LPS +miR-132-3p inhibitor 3 Yes Tukey 0.001 2B, IL-6 3 Yes One-way ANOVA F(3,8) = 55.19 <0.0001 Treatment 2B, IL-6, PBS vs LPS 3 Yes Tukey <0.0001 2B, IL-6, LPS+ inhibitor NC vs LPS +miR-132-3p inhibitor 3 Yes Tukey 0.005 2C, TNF-α 3 Yes One-way ANOVA F(3,8) = 38.98 <0.0001 Treatment 2C, TNF-α, PBS vs LPS 3 Yes Tukey <0.0001 2C, TNF-α, LPS+ inhibitor NC vs LPS +miR-132-3p inhibitor 3 Yes Tukey 0.0059 2C, IL-1β 3 Yes One-way ANOVA F(3,8) = 70.75 <0.0001 Treatment 2C, IL-1β, PBS vs LPS 3 Yes Tukey <0.0001 2C, IL-1β, LPS+ inhibitor NC vs LPS +miR-132-3p inhibitor 3 Yes Tukey 0.001 2C, IL-6 3 Yes One-way ANOVA F(3,8) = 86.8 <0.0001 Treatment 2C, IL-6, PBS vs LPS 3 Yes Tukey <0.0001 2C, IL-6, LPS+ inhibitor NC vs LPS +miR-132-3p inhibitor 3 Yes Tukey 0.001 3A 3 Yes One-way ANOVA F(2,6) = 343.2 <0.0001 Treatment 3A, mimic NC vs miR-132-3p mimic 3 Yes Tukey <0.0001 3B, TNF-α 3 Yes One-way ANOVA F(2,6) = 47.96 0.0002 Treatment 3B, TNF-α, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0003 3B, -IL-1β 3 Yes One-way ANOVA F(2,6) = 51.95 0.0002 Treatment 3B-IL-1β, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0003 3B, IL-6 3 Yes One-way ANOVA F(2,6) = 35 0.0005 Treatment 3B, IL-6, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0016 3C, TNF-α 3 Yes One-way ANOVA F(2,6) = 69.99 <0.0001 Treatment 3C, TNF-α, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0002 3C, IL-1β 3 Yes One-way ANOVA F(2,6) = 188.5 <0.0001 Treatment 3C, IL-1β, mimic NC vs miR-132-3p mimic 3 Yes Tukey <0.0001 3C, IL-6 3 Yes One-way ANOVA F(2,6) = 152.1 <0.0001 Treatment 3C, IL-6, mimic NC vs miR-132-3p mimic 3 Yes Tukey <0.0001 4A 3 Yes One-way ANOVA F(3,8) = 68.62 <0.0001 Treatment 4A, PBS vs LPS 3 Yes Tukey <0.0001 4A, LPS+inhibitor NC vs LPS+ miR-132-3p inhibitor 3 Yes Tukey 0.0050 4B 3 Yes One-way ANOVA F(3,8) = 114.1 <0.0001 Treatment 4B, PBS vs LPS 3 Yes Tukey <0.0001 4B, LPS+inhibitor NC vs LPS+ miR-132-3p inhibitor 3 Yes Tukey <0.0001 4C 3 Yes One-way ANOVA F(2,6) = 9.25 0.0147 Treatment 4C, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0461 4D 3 Yes One-way ANOVA F(2,6) = 17.59 0.0031 Treatment 4D, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0040 5A 3 Yes One-way ANOVA F(3,8) = 35.92 <0.0001 Treatment 5A, inhibitor NC vs miR-132-3p inhibitor 3 Yes Tukey 0.006 5A, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0089 5B 3 Yes One-way ANOVA F(3,8) = 13.63 0.0005 Treatment 5B, inhibitor NC vs miR-132-3p inhibitor 3 Yes Tukey 0.01 5B, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0382 5C, miR-132-3p 3 Yes One-way ANOVA F(3,8) = 115.1 <0.0001 Treatment 5C, miR-132-3p, IgG vs Ago2 3 Yes Tukey <0.0001 5C, GLRX 3 Yes One-way ANOVA F(3,8) = 126.1 <0.0001 Treatment 5C, GLRX, IgG vs Ago2 3 Yes Tukey <0.0001 5D, PBS vs LPS 3 Yes Two-way ANOVA F(2,12) = 12.1 0.0013 Interaction 5D, PBS vs LPS 3 Yes Two-way ANOVA F(2,12) = 168.8 <0.0001 Main effect 5F 3 Yes One-way ANOVA F(3,8) = 9.623 0.0050 Treatment 5F, wt-GLRX+ mimic NC vs wt-GLRX+miR-132-3p mimic 3 Yes Tukey 0.0044 6A 3 Yes One-way ANOVA F(2,6) = 75.16 <0.0001 Treatment 6A, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.002 6A, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey <0.0001 6B 3 Yes One-way ANOVA F(2,6) = 36.68 0.0004 Treatment 6B, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0165 6B, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey 0.004 6C, TNF-α 3 Yes One-way ANOVA F(2,6) = 43.7 0.0003 Treatment 6C, TNF-α, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0003 6C, TNF-α, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey 0.001 6C, IL-1β 3 Yes One-way ANOVA F(2,6) = 38.76 0.0004 Treatment 6C, IL-1β, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0004 6C, IL-1β, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey 0.002 6C, IL-6 3 Yes One-way ANOVA F(2,6) = 36.31 0.0004 Treatment 6C, IL-6, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0013 6C, IL-6, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey 0.0005 6D, TNF-α 3 Yes One-way ANOVA F(2,6) = 49.81 0.0002 Treatment 6D, TNF-α, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0002 6D, TNF-α, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey 0.0011 6D, IL-1β 3 Yes One-way ANOVA F(2,6) = 131.6 <0.0001 Treatment 6D, IL-1β, mimic NC vs miR-132-3p mimic 3 Yes Tukey <0.0001 6D, IL-1β, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey <0.0001 6D, IL-6 3 Yes One-way ANOVA F(2,6) = 65.52 <0.0001 Treatment 6D, IL-6, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0001 6D, IL-6, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey 0.003 6E 3 Yes One-way ANOVA F(2,6) = 8.975 0.0157 Treatment 6E, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0199 6E, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey 0.0312 6F 3 Yes One-way ANOVA F(2,6) = 15.91 0.004 Treatment 6F, mimic NC vs miR-132-3p mimic 3 Yes Tukey 0.0047 6F, miR-132-3p mimic vs miR-132-3p mimic+GLRX 3 Yes Tukey 0.0103 7A 6 Yes One-way ANOVA F(3,20) = 65.02 <0.0001 Treatment 7A, saline vs MPTP 6 Yes Tukey <0.0001 7A, MPTP+ antagomir NC vs MPTP+miR-132-3p antagomir 6 Yes Tukey 0.001 7B 6 Yes One-way ANOVA F(3,20) = 35.37 <0.0001 Treatment 7B, saline vs MPTP 6 Yes Tukey <0.0001 7B, MPTP+ antagomir NC vs MPTP+miR-132-3p antagomir 6 Yes Tukey 0.001
In this issue
