Article Figures & Data
Figures
- Figure 1.
Generation of Pvalb-Cre rats. A, Schematic of the Pvalb-iCre transgene produced by recombineering BAC CH230-499N20 which contains 17 kb of endogenous sequence upstream of the Pvalb start codon. Pvalb-iCre rats were injected bilaterally with AAV Nuc-flox-(mCherry)-eGFP into the OFC and brains processed for fluorescent imaging four weeks later. B, Unrecombined AAV genomes express mCherry in the OFC (red) and have minimal colocalization with Pvalb-positive cells (blue). Inset shows high magnification of a mCherry+, Pvalb+ cell (blue arrow), and a mCherry+, Pvalb– cell (white arrow). C, Cre-recombination leads to GFP-positive cells (Cre recombined; green) which showed colocalization with Pvalb (blue). Inset is high magnification example of a GFP+, Pvalb+ cell (blue arrow) and a GFP+, Pvalb– cell (white arrow). D, Quantitation of colocalization of mCherry (unrecombined) and GFP (Cre-recombined) with Pvalb-positive cells. *p = 0.038, paired t-test. E–J, Rats were injected with AAV EF1a DIO hChR2-eYFP and immunostained for parvalbumin 20 d later. At low magnifications, diffuse Pvalb-immunoreactivity (E) and focal ChR2-EYFP (F) expression in the OFC. At higher magnification, distinct Pvalb-immunopositive cells are present in OFC (H) and a mesh-like pattern of fluorescence from ChR2-EYFP expressed throughout cell bodies and processes in the OFC (I). In cells clearly exhibiting somal expression of ChR2-EYFP (white triangle), there is corresponding expression of Pvalb (J). Pvalb-positive cells that do not colocalize with ChR2-EYFP are indicated white arrow). Scale bars: 50 μm (B, C, H, J), 20 μm (inset), and 1000 μm (E–G).
- Figure 2.
A, Schematic illustration of virus injection site in the lateral OFC (+4.0 mm anterior of Bregma; –2.0 mm from midline, −4.3 mm ventral to skull surface; adapted from Paxinos and Watson, 1998). B, OFC PyN filled with biocytin bound to an Alexa Fluor 594 conjugate (white arrow). Also shown is a biocytin-filled cell that also expresses eYFP (blue arrow) in a Pvalb-iCre rat, three weeks after receiving an OFC injection with the ChR2-eYFP viral construct. C, DIC video microscopic image showing an OFC neuron (yellow circle) in a living rat brain slice from a Pvalb-iCre rat. A patch electrode is shown to the right (v-shaped structure). D, The same neuron (white circle) as in C, under fluorescence illumination, and through the same objective in a Pvalb-iCre rat, three weeks after injection with the ChR2-eYFP virus (scale bar for C, D).
- Figure 3.
Properties of eYFP-positive (eYFP+) and eYFP-negative (eYFP–) neurons in the OFC of Pvalb-iCre rats, three weeks after injection of viral construct expressing eYFP and ChR2. A, left, Mean effect of depolarizing currents (80–300 pA, 500 ms), passed through whole-cell recording electrodes, on action potential firing frequency in eYFP+ and eYFP– cells. eYFP+ cells showed a significantly higher frequency of action potential discharge, compared with eYFP– cells (significant interaction between eYFP and current injection; F(11,231) = 30.23, two-way RM ANOVA). Inset, Representative examples from single cells responding to +300-pA current injection. B, Mean I–V relationships in response to subthreshold current injections (–30 to +50 pA, 500 ms) in eYFP+ and eYFP– cells. Membrane potential measurements were made during the final 20 ms of the current step. i–iii show membrane voltage responses to current injection in representative eYFP+ and eYFP– neurons, as well as the current steps to evoke these responses (iii). C, Peak inward currents elicited by ChR2 activation with 473-nm laser light pulses of varying power in a single eYFP+ OFC neuron. The inset shows membrane currents in response to different intensities of 473-nm light (blue bar). The later current response is used to measure Rin. The cell was voltage clamped at −65 mV. D, Mean ± 95% CI maximum inward currents indicating that light-evoked responses were observed in eYFP+ cells, and not in eYFP– cells (N, n = 4, 15; unpaired t test, t(22) = 5.804, p < 0.0001). In these experiments, GABAergic currents were blocked by picrotoxin (Ptx; 50 μm) to eliminate IPSCs arising from activation of nearby eYFP+ cells.
- Figure 4.
Optogenetic stimulation of OFCPV cells evokes monosynaptic IPSCs in OFC PyNs. The diagram indicates the recording and light-stimulation configuration. Recordings were made in OFC PyNs and stimulation of ChR2 expressed in OFCPV neurons with blue light passed through the microscope objective (OBJ). A, top panel, Individual traces of paired (50-ms interval) optical IPSCs (oIPSCs) evoked by stimulation ChR2 with 473-nm light, recorded in an eYFP– cell. Bottom panel, Individual and mean (±95% CI) peak first response to light stimulation showing latency to 50% peak oIPSC (2.78 ± 1.05 ms) and jitter (0.20 ± 0.16 ms). B, top panel, Representative sample of a paired synaptic response to 473-nm stimulation that is eliminated by the GABAA receptor antagonist gabazine (Gbz; 10 μm, gray trace). Bottom panel, Summary of first oIPSC amplitudes recorded from OFC PyNs demonstrating complete elimination of the response by Gbz (N, n = 6, 14, paired t(13) = 6.49, p < 0.0001).
- Figure 5.
Effects of 5-HT and the 5-HT2A/2C antagonist ketanserin (Ket; 10 μm) on OFCPV cell Iholds in cocaine-naive rats. A, Time course of mean (±SEM) inward currents caused by bath application of 5-HT (20 μm, horizontal gray bar) alone, or during treatment with ketanserin in male Pvalb-iCre rats (N, n = 7, 13). Inward currents with 5-HT alone were observed in the majority of OFCPV neurons in males and females (22/28 cells, 11 rats, 78.6%). B, Time course of mean (±SEM) inward currents caused by bath application of 5-HT alone, or during application of ketanserin in female Pvalb-iCre rats (N, n = 4, 11). C, Mean (±SEM) outward 5-HT-induced currents were observed in a minority of male OFCPV cells (4/28 cells, 14.3%). D, Mean maximal effects of 5-HT alone, or during application of ketanserin in OFCPV neurons from male and female Pvalb-iCre rats. The effects of 5-HT under control and ketanserin conditions were obtained by averaging data across the final 3 min of the 5-HT application periods shown in A, B. Note that although the magnitudes of the 5-HT-induced inward currents did not differ between male and female OFCPV neurons in the control condifontstion, they were significantly blocked by ketanserin only in female Pvalb-iCre rats (two-way ANOVA, sex × treatment interaction F(1,27) = 8.671, p = 0.0066; Tukey’s post hoc comparisons, male 5-HT vs ketanserin p > 0.9999, female 5-HT vs ketanserin, **p = 0.0007, male vs female ketanserin, *p = 0.0116). ns, not significant.
- Figure 6.
Excitatory transmission onto OFCPV cells differs between male and female rats and is insensitive to 5-HT. A, Representative traces of sEPSCs from male and female OFCPV cells from Pvalb-iCre rats. B, Mean cumulative probability histogram of interevent intervals (IEIs) showing significantly (p < 0.0001, Kolmogorov–Smirnov test) larger intervals between sEPSC in OFCPV cells from naive female rats, compared with males. C, Representative sEPSC traces in an OFCPV neuron from a male rat before (control) and during 5-HT (20 μm) application. D, Mean (±95% CI) sEPSC frequency recorded in OFCPV neurons in male and female Pvalb-iCre rats. sEPSC frequency was significantly lower in cells from female rats (significant main effect of sex, F(1,30) = 20.52, p < 0.0001, two-way ANOVA; p = 0.011, Tukey’s post hoc test), but 5-HT application did not significantly change sEPSC frequency in males or females (main effect of treatment, F(1,30) = 0.199, p = 0.66, two-way ANOVA; p = 0.011, p = 0.97, and p = 0.99, respectively, Tukey’s post hoc test). *p < 0.05, Tukey’s post-hoc test. E, Mean (±95% CI) sEPSC amplitudes recorded in OFCPV neurons in male and female Pvalb-iCre rats during baseline, and 5-HT application periods. The sEPSC amplitudes did not differ between male and female rats, and there were no significant effects of 5-HT on sEPSC amplitude (F(1,30) = 0.00164, p = 0.97, two-way ANOVA). ns, not significant.
- Figure 7.
Effects of 5-HT on trains of oIPSCs recorded in OFC PyNs following light-activation of OFCPV cells. The recording configuration is the same as described in Figure 4. A, Traces of oIPSCs obtained from an OFC PyN before (control, orange line) and during 5-HT (20 μm) application (black line). The lower traces are those shown in the gray dashed box, plotted on an expanded timescale. B, Mean (±SEM) of the effect of 5-HT on trains of oIPSCs evoked at 10 Hz (n = 21 cells) or 20 Hz (n = 19 cells), expressed as a percentage of control responses recorded before 5-HT-application. The oIPSCs activated at both frequencies were significantly increased by 5-HT (RM two-way ANOVA; 10-Hz train, treatment effect = F(1,20) = 6.1, p = 0.023; 20-Hz train, treatment effect = F(1,18) = 4.618, p = 0.045).
- Figure 8.
OFCPV interneuron membrane properties and sensitivity to 5-HT following CSA in male and female Pvalb-iCre rats. A, Mean number of lever presses for cocaine in male and female Pvalb-iCre rats. B, Mean cocaine intake for all Pvalb-iCre rats across all self-administration trials. Male and female rats self-administered a similar amount of cocaine (unpaired t test, t(22) = 1.46, p = 0.158). Legend applies to C, D. C, Mean (±95% CI) RMP of OFCPV neurons from naive male and female rats and those withdrawn from CSA. Cells from male rats were significantly depolarized (less negative RMP) following CSA withdrawal (two-way ANOVA, sex × treatment interaction, F(1,35) = 13.26, p = 0.0009); male naive versus male CSA (**Tukey’s post hoc test, p = 0.0015), whereas those from females were unchanged (ns, p = 0.70, Tukey’s post hoc test). **p < 0.01, Tukey’s post-hoc test. D, Mean (±95% CI) Ihold necessary to voltage clamp OFCPV cells at −65 mV. Consistent with the changes in RMP, cells from male rats required more Ihold after CSA (two-way ANOVA, sex × treatment interaction, F(1,68) = 9.115, p = 0.0036; male naive vs male CSA, p <0.0001, Tukey’s post hoc test), and cocaine exposure did not change Ihold in OFCPV neurons from female rats (female naive vs female CSA, p = 0.9962, Tukey’s post hoc test). **p < 0.01, Tukey’s post-hoc test. E, F, Withdrawal from CSA did not alter the action potential discharge frequency of OFCPV cells caused by depolarizing current injection in either males or females (two-way ANOVA, F(7,21) = 1.288, p = 0.3047). G, H, Mean time course of the effects of 5-HT on Ihold in OFCPV neurons from male and female naive and CSA rats. No changes in the sensitivity of OFCPV neurons to 5-HT were observed in cells from males (unpaired t test, t(38) = 0.6226, p = 0.5373) or females (t(38) = 0.0742, p = 0.9412) following withdrawal from CSA. ns, not significant.
- Figure 9.
Properties of sEPSCs in OFCPV interneurons following CSA and lack of effects of 5-HT in Pvalb-iCre rats. A, Representative traces showing sEPSCs from male (blue traces) and female (orange traces) OFCPV cells from naive rats and those withdrawn from CSA. B, Mean (±95% CI) sEPSC frequency in OFCPV cells from male and female naive rats and those withdrawn from CSA. There was a significant reduction in sEPSC frequency in male OFCPV cells following CSA (two-way ANOVA, sex × treatment interaction, F(1,39) = 12.05, p < 0.0013, main effect sex, F(1,39) = 4.434, p = 0.0417, treatment main effect, F(1,39) = 2.057, p = 0.160; Tukey’s post hoc test male naive vs male CSA, p = 0.006), and naive female rats exhibited a significantly lower frequency of sEPSCs compared with naive males (p = 0.005, Tukey’s). **p < 0.01, Tukey’s post-hoc test. Legend applies to C, D. C, Mean (±95% CI) sEPSC amplitude in OFCPV cells from male and female naive rats and those withdrawn from CSA. No changes in sEPSC amplitude were observed (two-way ANOVA, sex × treatment interaction, F(1,38) = 0.064, p = 0.802). D, Mean (±95% CI) effect of 5-HT (20 μm) on sEPSC frequency in OFCPV cells from male and female naive Pvalb-iCre rats and those withdrawn from CSA. There was no effect of 5-HT on OFCPV cells from naive or CSA-withdrawn rats (two-way ANOVA, sex × treatment interaction, F(1,38) = 0.582, p = 0.450). ns, not significant.
Tables
Primer name Primer Seq Target gene Ggt1 probe (HEX, IBFQ) CCGAGAAGCAGCCACAGCCATACCT Ggt1 Ggt1pF CCACCCCTTCCCTACTCCTAC Ggt1 Ggt1pR GGCCACAGAGCTGGTTGTC Ggt1 iCrepF ATGGTGCCCAAGAAGAAGAG iCre iCre probe (FAM, IBFQ) AAGTCTCCAACCTGCTGACTGTGC iCre iCrepR CTTCCTGACTTCATCAGAGGTG iCre Figure reported N,
# ratsn,
# cellsNorm.
dist?*Statistic Statistic
value
(df)p value Variance
sourcePost hoc
testPost hoc p Mean
differenceLower
95% CIUpper
95% CI1D, mCherry vs GFP 6 N/A N/A Unpaired t test t(10) = 3.75 0.0038 Difference 36.4 14.75 58.04 3A, eYFP vs No eYFP (current inject vs eYFP) 11 23 Yes Two-way RM-ANOVA F(11,231) = 30.23 <0.0001 Interaction 55.91 34.80 77.00 3A, eYFP+ vs eYFP (current inject) 11 23 Yes Two-way RM-ANOVA F(11,231) = 51.63 <0.0001 Main effect 3A, eYFP+ vs eYFP (eYFP) 11 23 Yes Two-way RM-ANOVA F(1,21) = 17.61 0.00040 Main effect 3D, eYFP+ vs eYFP (max current) 4 15 Yes Unpaired t test t(22) = 5.804 <0.0001 Difference 82.03 55.61 108.50 4B, control 6 14 Yes 4B, gabazine 6 14 Yes Paired t test t(13) = 6.485 <0.0001 Difference −101.90 −135.80 −67.95 5A, Rin (data not shown 11 28 Yes Unpaired t test t(21) = 1.25 0.2250 Difference 102.60 98.25 107.00 5A,B, control 11 22 Unpaired t test t(80) = 0.38 0.0970 Difference −0.104 −5.46 5.25 5C, outward I 11 4 One-sample test t(40) = 7.94 <0.0001 Difference 9.20 6.86 11.50 5D, ketanserin, male vs female 8 16 Yes Two-way ANOVA F(1,27) = 8.671 0.0066 Interaction 5D, ketanserin, male vs female 8 16 Two-way ANOVA F(1,27) = 8.135 0.0082 Main effect (sex) 5D, ketanserin, male vs female 8 16 Two-way ANOVA F(1,27) = 3.694 0.0652 Main effect (treatment) 5D, ketanserin, male vs female 8 16 Male vs female 5-HT Tukey 0.880 5.30 −14.31 24.92 5D, ketanserin, male vs female 8 16 Male 5-HT vs +ketanserin Tukey >0.999 0.48 −21.17 22.13 5D, ketanserin, male vs female 8 16 Female 5-HT vs +ketanserin Tukey 0.0007 −30.06 −48.41 −11.71 5D, ketanserin, male vs female 8 16 Female ketanserin vs Male ketanserin Tukey 0.0116 −25.24 −45.75 −4.72 6Bz, sEPSC interevent male vs female 8 17 Yes Kolmogorov–Smirnov 0.6455 <0.0001 Difference 177.7 168.00 187.30 6D, sEPSC frequency male vs female and 5-HT 8 17 Yes Two-way ANOVA F(1,30) = 0.0402 0.842 Interaction 6D, sEPSC frequency male vs female 8 17 Yes Two-way ANOVA F(1,30) = 20.52 <0.0001 Main effect (sex) 6D, sEPSC frequency 5-HT 8 17 Yes Two-way ANOVA F(1,30) = 0.1990 0.6590 Main effect (5-HT) 6D, sEPSC frequency male vs female 8 17 Male vs Female baseline sEPSC Tukey 0.011 12.31 2.30 22.32 6D, sEPSC frequency male vs female and 5-HT 8 17 Male baseline vs male 5-HT Tukey 0.970 1.68 −8.62 11.98 6D, sEPSC frequency male vs female and 5-HT 8 17 Female baseline vs female 5-HT Tukey 0.998 0.64 −9.07 10.35 6E, sEPSC amplitude 5-HT 8 17 Yes Two-way ANOVA F(1,30) = 0.0016 0.9680 Interaction 6E, sEPSC amplitude 5-HT 8 17 Yes Two-way ANOVA F(1,30) = 0.0085 0.9270 Main effect (sex) 6ED, sEPSC amplitude 5-HT 8 17 Yes Two-way ANOVA F(1,30) = 0.0054 0.9418 Main effect (5-HT) 7B, 10-Hz train 8 21 N/A Two-way ANOVA F(1,20) = 6.100 0.0226 Treatment 8.86 −26.95 44.67 7B, 20-Hz train 8 19 N/A Two-way ANOVA F(1,18) = 4.618 0.0455 Treatment 3.97 −36.12 44.06 8B, total cocaine intake male-female 17 N/A Unpaired t test t(22) = 1.463 0.1577 Difference 4.89 −2.04 11.82 8C, CSA, RMP 19 45 Yes Two-way ANOVA F(1,35) = 13.26 0.0009 Interaction 8C, CSA, RMP 19 45 F(1,35) = 2.279 0.1401 Main effect (sex) 8C, CSA, RMP 19 45 F(1,35) = 4.459 0.0419 Main effect (treatment-CSA) 8C, CSA, RMP 19 45 Yes Naive male vs naive female Tukey 0.520 −4.50 −13.30 4.30 8C, CSA, RMP 19 45 Yes Naive male vs CSA male Tukey 0.0015 −12.15 −20.26 −4.03 8C, CSA, RMP 19 45 CSA male vs CSA female Tukey 0.0014 10.88 3.646 18.10 8C, CSA, RMP 19 45 Naive female vs CSA female Tukey 0.698 3.23 −4.763 11.22 8D, CSA, I-Hold 30 72 Yes Two-way ANOVA F(1,68) = 9.115 0.0036 Interaction 8D, CSA, I-Hold 30 72 F(1,68) = 0.0036 0.9521 Main effect (sex) 8D , CSA, I-Hold 30 72 F(1,68) = 7.145 0.0094 Main effect (treatment-CSA) 8D, CSA, I-Hold 30 72 naive male vs naive female Tukey 0.261 35.51 −15.164 86.19 8D, CSA, I-Hold 30 72 Naive male vs CSA male Tukey <0.0001 68.32 29.495 107.15 8D, CSA, I-Hold 30 72 Naive female vs CSA female Tukey 0.996 −4.15 −54.050 45.74 8D, CSA, I-Hold 30 72 CSA male vs CSA female Tukey 0.057 −36.96 −74.761 0.84 8E, firing, male CSA 8 17 Yes One-way RM-ANOVA F(7,21) = 1.288 0.3047 Treatment −2.421 −23.500 18.70 8F, firing, female CSA 11 24 Yes One-way RM-ANOVA F(7,21) = 1.288 0.3047 Treatment 6.67 −9.047 22.36 8G, Ihold 5-HT, CSA, male 16 39 N/A Unpaired t test t(38) = 0.6226 0.5373 Treatment −1.625 −6.909 3.66 8H, Ihold 5-HT, CSA, female 14 30 N/A Unpaired t test t(38) = 0.0742 0.9412 Treatment −0.290 −8.154 7.58 8, data (male female proportions) 30 66 N/A Fisher’s N/A 0.7021 Treatment N/A N/A N/A 8 data (male female days CSA withdrawal) 30 66 Yes Unpaired t test t(17) = 1.733 0.1013 Sex 18.82 −4.098 41.74 9B, sEPSC frequency male vs female CSA 19 43 Yes Two-way ANOVA F(1,39) = 12.05 0.0013 Interaction 9B, sEPSC frequency male vs female CSA 19 43 F(1,39) = 4.434 0.0417 Main effect (sex) 9B, sEPSC frequency male vs female CSA 19 43 F(1,39) = 2.057 0.1595 Main effect (treatment-CSA) 9B, sEPSC frequency male vs female CSA 19 43 Naive male vs naive female Tukey 0.0047 12.31 3.137 21.49 9B, sEPSC frequency male vs female CSA 19 43 Naive male vs CSA male Tukey 0.006 10.83 2.563 19.10 9B, sEPSC frequency male vs female CSA 19 43 Naive female vs CSA female Tukey 0.494 −4.50 −12.984 3.99 9B, sEPSC frequency male vs female CSA 19 43 CSA male vs CSA female Tukey 0.704 −3.02 −10.510 4.48 9C, sEPSC amplitude male vs female CSA 19 42 Yes Two-way ANOVA F(1,38) = 0.0691 0.8018 Interaction 9C, sEPSC amplitude male vs female CSA 19 42 F(1,38) = 0.1930 0.6629 Main effect (sex) 9C, sEPSC amplitude male vs female CSA 19 42 F(1,38) = 1.998 0.1657 Main effect (treatment-CSA) 9D, sEPSC frequency male vs female CSA, 5-HT 19 42 Yes Two-way ANOVA F(1,38) = 0.5817 0.4503 Interaction 9D, sEPSC frequency male vs female CSA, 5-HT 19 42 F(1,38) = 0.3550 0.5548 Main effect (sex) 9D, sEPSC frequency male vs female CSA, 5-HT 19 42 F(1,38) = 0.095 0.7600 Main effect (treatment-CSA) * D’Agostino–Pearson test of normality.
In this issue
