Article Figures & Data
Figures
- Figure 1.
exp-1 mutants show defects in AWC-dependent chemosensation. A, Graph indicating chemotaxis indices for AWC-sensed attractants, IAA, benzaldehyde, and 2-butanone used at 1:1000 dilution for WT and exp-1 animals. B, Response of WT and exp-1 C. elegans toward the AWA-sensed attractant diacetyl (1:1000). C, Avoidance response of exp-1 and WT animals toward the AWB-sensed odors, Nonanone and 1-octanol (1:100 dilution for both). Each circle in the graphs represents one assay performed using ∼200–250 C. elegans for all graphs from A–C. D, Defects in exp-1 mutants were rescued using the endogenous exp-1 promoter. Each circle or triangle in the graph represents one assay performed using ∼200–250 C. elegans. E, Tracks of WT (left panel), exp-1 (middle panel), and the exp-1 rescuing line (right panel) animals during chemotaxis toward IAA. F, Fluorescent confocal images of the AWC neuron of WT and exp-1 mutants expressing Pstr-2::GFP. In all graphs, the error bars represent SEM; p values are indicated as ***p < 0.001; ns, not significant in all graphs based on p values calculated using one-way ANOVA with Bonferroni multiple comparison test.
- Figure 2.
EXP-1 is expressed in the ASI amphid neuron and regulates AWC-dependent chemotaxis in a non-cell autonomous manner. A, Localization of Pexp-1::wrmScarlet with respect to the AWC neuron marked with GFP (top panel), ASH neurons marked with GFP (middle panel), and the ASI neurons marked with GFP (bottom panel). B, Illustration of the ciliary region of the ASI neuron toward the amphid pore (left panel). Confocal images of the ciliary region of the ASI neuron from WT (upper right panel) and exp-1 mutants (lower right panel). The bottom panel indicates a graph depicting the distance of the ciliary end from the externally exposed end of the amphid pore as shown in the illustration. This was measured as an arbitrary unit (A.U.) by using the analysis tool of FIJI. Each circle corresponds to one animal. C, AWC-dependent chemotaxis defect of exp-1 mutants were rescued by ASI-specific expression of EXP-1. Each circle or triangle in the graph represents one assay performed using ∼200–250 C. elegans. Error bars represent SEM; p values are indicated as ***p < 0.001; ns, not significant in all graphs based on p values calculated using one-way ANOVA with Bonferroni multiple comparison test.
- Figure 3.
The chemotaxis defects of exp-1 require a functional AWC neuron. A, Graph indicating chemotaxis indices of exp-1; ceh-36 C. elegans along with control animals. B, Graph indicating chemotaxis indices of tax-2; exp-1 and exp-1; tax-4 C. elegans along with control animals. Each circle, quadrilateral, or triangle in the graphs represents one assay performed using ∼200–250 C. elegans. Error bars represent SEM; p values are indicated as ***p < 0.001, **p < 0.001, and *p < 0.05 in all graphs based on p values calculated using one-way ANOVA with Bonferroni multiple comparison test. C, Fluorescence images of AWC neuron showing co-expression of STR-2 (top panel) and DAF-1 proteins (middle and bottom panels).
- Figure 4.
Mutants in daf-7 suppress the exp-1 mutant phenotype. A, Graph indicating chemotaxis indices of exp-1; daf-7 animals along with control C. elegans. B, Pstr-2::GFP expression in exp-1; daf-7 mutants along with WT and single mutant animals. C, Graph indicating chemotaxis indices of exp-1; str-2 C. elegans along with control animals. Each circle in graphs A, C represents one assay performed using ∼200–250 C. elegans. Error bars represent SEM; p values are indicated as ***p < 0.001, *p < 0.05; ns, not significant in all graphs based on p values calculated using one-way ANOVA with Bonferroni multiple comparison.
- Figure 5.
Loss of str-2 in the daf-7 mutant background leads to an enhanced dauer phenotype that is further enhanced in the absence of exp-1. Dauer assays were performed for the exp-1; daf-7; str-2 mutant animals along with WT, single mutant, and double mutant C. elegans. The assay was performed at three temperatures: (A) 16°C, (B) 20°C, and (C) 25°C. Each circle in the graphs represents a single experiment performed using ∼200–300 animals per plate. Error bars represent SEM; p values are indicated as ***p < 0.001, **p < 0.01, *p < 0.05; ns, not significant in all graphs based on p values calculated using one-way ANOVA with Bonferroni multiple comparison test where relevant.
- Figure 6.
STR-2 expression in ASI neurons completely rescues the dauer phenotype and partially rescues the chemotaxis defects of exp-1; daf-7; str-2 mutant animals. A, STR-2 rescue of the dauer phenotype of daf-7; str-2 mutant animals along with controls. This experiment was performed at 20°C. B, STR-2 rescue of the dauer phenotype of exp-1; daf-7; str-2 mutant animals along with controls. This experiment was performed at 20°C. A, B, Each circle or triangle in the graphs represents a single experiment performed using ∼200–300 animals per 60-mm plate. C, Graph representing chemotaxis indices for STR-2 rescue assays performed in double mutant (daf-7; str-2) animals along with controls. D, Graph representing chemotaxis indices for STR-2 rescue assays performed in triple mutant (exp-1; daf-7; str-2) animals along with controls. Each circle or triangle in graphs C, D, represents one assay performed using ∼200–250 C. elegans. Error bars represent SEM; p values are indicated as ***p < 0.001, **p < 0.01, *p < 0.05; ns, not significant in all graphs based on p values calculated using one-way ANOVA with Bonferroni multiple comparison test where relevant.
- Figure 7.
Mutants of dbl-1 (TGFβ/BMP-like ligand) along with daf-7 mutants resulted in dauer as well as chemotaxis defective phenotypes. A, Graph indicating the dauer phenotype of daf-7; dbl-1 C. elegans along with control animals. This experiment was performed at 20°C. Each circle in the graphs represents a single experiment performed using ∼200–300 animals per 60-mm plate. B, Graph indicating chemotaxis indices of daf-7; dbl-1 C. elegans along with control animals. Each circle in the graphs represents one assay performed using ∼200–250 C. elegans. Error bars represent SEM; p values are indicated as ***p < 0.001, **p < 0.01, *p < 0.05; ns, not significant in all graphs based on p values calculated using one-way ANOVA with Bonferroni multiple comparison test where relevant. C, A predicted model for how AWC-dependent and ASI-dependent chemosensory cues could lead to dauer formation. i, Normally AWC is responsible for sensing attractive odors and ASI senses food-dependent odors. They communicate with each other and maintain the reproductive phase of the organism. ii, In the absence of exp-1, ASI neuron is able to sense the volatile odors because of retracted cilia. Here, levels of DAF-7 are low (EXP-1 regulates DAF-7 expression levels) and as a result the communication between AWC and ASI is aberrant. Moreover, ASI also has strong connections with downstream interneurons (AIB, AIY, AIA), which are normally involved in AWC chemosensory signaling leading to chemosensory bias between AWC and ASI neuron signaling and hence repulsion toward attractive odors. iii, In the absence of daf-7, STR-2 expression in the ASI neuron is upregulated and our results indicate that both STR-2 and EXP-1 might be sensing food odors and communicating with the AWC neuron through an alternate pathway (possibly DBL-1 dependent). This could explain why double mutants of daf-7 with str-2, exp-1, and dbl-1 all show increased percentage of dauers as compared with daf-7 single mutants. Moreover, triple mutants of daf-7 with both str-2 and exp-1 mutations show an exaggerated dauer phenotype, possibly because of the loss of the alternate food sensory pathway (dashed line) in the absence of daf-7.
Tables
Strain Genotype Comments EG276 exp-1(ox276) II 3× out crossed (CGC strain) RB2302 Daf-7(ok3125 )III 3× out crossed (CGC strain) VC3044 dbl-1(ok3749) V 3× out crossed (CGC strain) VC2413 str-2(ok3089) V 3× out crossed (CGC strain) RB2464 tax-2(ok3403 )I 3× out crossed (CGC strain) VC3113 tax-4(ok3771) III 3× out crossed (CGC strain) FK311 ceh-36(ks86) X 3× out crossed (CGC strain) FK181 ksIs2[Pdaf-7::GFP + rol-6(su1006)] 3 × out crossed (CGC strain) CX3695 Pstr-2::GFP(kyIs140) CGC strain BAB1415 exp-1(ox276); str-2 (ok3089) This study BAB1421 exp-1(ox276); daf-7(ok3125); str-2(ok3089) This study BAB1424 exp-1(ox276); daf-7(ok3125) This study BAB0881 exp-1(ox276); ceh-36(ks86) This study BAB0882 tax-2(ok3403; exp-1(ox276) This study BAB0880 exp-1(ox276); tax-4(ok3771) This study BAB1577 daf-7(ok3125); str-2(ok3089) This study BAB1588 exp-1/Pexp-1::EXP-1in pPD95.75 (indEx892) This study BAB1589 WT/Pexp-1::EXP-1::sl2::wrmScarlet (indEx893) This study BAB1590 exp-1/Pexp-1::EXP-1::sl2::wrmScarlet (indEx894) This study BAB1591 exp-1/ Pgpa-4::EXP-1::sl2::wrmScarlet (indEx895) This study BAB1592 (indEx894)/Psrb-6::GFP (indEx896) This study BAB1593 exp-1;str-2/Pgpa-4::STR-2::sl2::wrmScarlet (indEx897) This study BAB1594 exp-1;str-2/Pstr-2::STR-2::sl2::wrmScarlet (indEx898) This study BAB1595 kyIs140/Pdaf-1::sl2::wrmScarlet (indEx899) This study Primer code Sequence Comment Gene PRS 40 CGT GGC GAG ACC CTC GAC Forward external exp-1 PRS 41 CTC GAA CGT AGC CGC CAA TTC Forward internal exp-1 PRS 42 GTG CCA ACT TTA TCA GGG AGA G Reverse external exp-1 PRS 439 AGGACGGAAATTACCTGTGC Forward external daf-7 PRS 440 GCTTCGGGAAACGCTCATAT Reverse external daf-7 PRS 441 TTATTCTTTCTTGTCGGGGCC Reverse internal daf-7 PRS 362 CTATTGCTTGCGCTCATAGGAAG Genotyping forward external str-2 PRS 363 CTTCAGTCATCATGTTGCACAATTTC Genotyping reverse external str-2 PRS 364 GTGTAATGTGGATTATACTTGTCAG Genotyping reverse external str-2 PRS 426 AGCTGTTGTCTCCTTCCAGG Genotyping forward WT tax-2 PRS 427 CGATTTCCGATGAGGAAACC Genotyping forward mutant tax-2 PRS 428 CACAGCTTCTAATAGGAAAGGG Genotyping reverse Common tax-2 PRS 394 GCGGTTCGGATACGAAAATACTTG Genotyping forward external tax-4 PRS 395 GACGGAGAAGTGTATCCGTTATATC Genotyping reverse internal tax-4 PRS 396 CCATGCGTCCGTCCCTAATCC Genotyping reverse external tax-4 PRS 403 GTGTGGTACCCAAGTTGATAGG Genotyping forward common ceh-36 PRS 404 GTTTTCCGCGAAACACAGTACC Genotyping reverse WT ceh-36 PRS 405 GTTTTCCGCGAAACACAGTACT Genotyping reverse M ceh-36 PRS 576 GGAGAGTCGTCATCGGCG Genotyping forward external dbl-1 PRS 577 GGCATTGGATTTGGACAAGAGC Genotyping reverse external dbl-1 PRS 578 CTGTGCAGACTGGTCCGAG Genotyping forward internal dbl-1 PRS 349 AAAACTGCAGcttgagagatccaatgaaatcgg Cloning forward PstI exp-1 promoter in pPD95.75 PRS 351 CTAGTCTAGAgccatcaagttttggcag Cloning reverse XbaI exp-1 promoter in pPD95.75 PRS 352 GGGGTACCatgtctgcatctattctaattttg Cloning forward KpnI exp-I Genomic in pPD95.75 PRS 353 CCGCTCGAGctagtagatgtcggcaaaccactc Cloning reverse XhoI exp-I Genomic in pPD95.75 PRS 369 ACATGCATGCgaacggtctgtgggctctgac Cloning forward SphI str-2 promoter PRS 370 AAAACTGCAGgcagacccatatgtgtgcacaaac Cloning reverse PstI str-2 promoter PRS 515 ACATGCATGCgaagccttgtttgtataagaaacgctg Cloning forward SphI gpa-4 promoter PRS516 CCCCCCGGGGttgaaaagtgttcacaaaatgaataagtg Cloning reverse XmaI gpa-4 promoter PRS 561 CACTTTTCAACGGatccccgggatgccgactgtgcaatgg Cloning forward XmaI str-2 genomic in a wrmScarlet vector PRS 566 GGGGTACCgcttgcgctcataggaagag Cloning reverse KpnI str-2 genomic in a wrmScarlet vector PRS 534 ACATGCATGCcggtcaccattcccaaattcgc Cloning forward SphI daf-1 promoter PRS 535 GGGGTACCcttgcacaggtaccaatttatgatg Cloning reverse KpnI daf-1 promoter S. number Plasmid number Plasmid 1 pBAB0056 Pexp-1::EXP-1in pPD95.75 2 pBAB0063 Pexp-1::EXP-1::sl2::wrmScarlet 3. pBAB0067 Pgpa-4::EXP-1::sl2::wrmScarlet 4. pBAB0069 Pgpa-4::STR-2::sl2::wrmScarlet 5. pBAB0070 Pstr-2::STR-2::sl2::wrmScarlet 6. pBAB0071 Pdaf-1::sl2::wrmScarlet 7. pBAB465 Psrb-6::GFP (Kadam et al., 2021)
Extended Data Figure 4-1
STR-2 functions in the AWC neurons to participate in exp-1 mutant behavior. A, Graphs for exp-1; str-2 strain transformed with STR-2 gene expressed under the ASI-specific promoter gpa-4 along with controls. B, Graphs for exp-1; str-2 strain transformed with STR-2 gene expressed under the AWC-specific promoter str-2 along with controls. Error bars represent SEM; ***p < 0.001, **p < 0.01, *p < 0.05, ns, not significant in all graphs based on p values calculated using one-way ANOVA with Bonferroni multiple comparison test where relevant. Download Figure 4-1, EPS file.
In this issue
