Article Figures & Data
Figures
- Figure 1.
Impact of deletion of ATG7 in microglia on seizure susceptibility. A, Western blot analysis of p62 in ATG7KO mice and their littermate controls. B, Quantification of p62 protein levels in ATG7KO mice and their littermate controls; n = 6 (3 M, 3 F). The unpaired mean difference (hereafter referred to as UMD) between control and ATG7KO is 1.02e+02 (95.0%CI 85.1, 1.21e+02). The p value of the two-sided permutation t test (hereafter referred to as pt) is 0.0008. C, Quantification of latency to fall in the rotarod test in 21 littermate control (11 M, 10 F) and 23 ATG7KO mice (10 M, 13 F). Two-way ANOVA with repeated measures; group effect: F(4,110) = 63.46, p < 0.0001; time effect: F(4,110) = 294.1, p < 0.0001; interaction: F(4,110) = 3.104, p = 0.0184 (CI = 95%). D, Quantification of total distance traveled in the OFT in 21 littermate control (11 M, 10 F) and 23 ATG7KO mice (10 M, 13 F). UMD: −2.48 (95.0%CI −4.05, −0.791); pt = 0.0068. E, Pilocarpine doses to induce SE in in 23 control (10 M, 13 F) and 22 ATG7KO (12 M, 10 F) mice. UMD: −1.48e+02 (95.0%CI −1.82e+02, −1.15e+02); pt = 0.0. F, Percentage of control and ATG7KO mice surviving SE induced by pilocarpine in 23 control (10 M, 13 F) and 22 ATG7KO (12 M, 10 F) mice. Log-rank (Mantel–Cox) test: p < 0.0001. G, Percentage of control and ATG7KO mice surviving SE induced by kainic acid (0.5 μl of 20 and 50 μm) injected into the dorsal dentate gyrus of the hippocampus; n = 6 (3 M, 3 F). Log-rank (Mantel–Cox) test: p = 0.0009 between control+KA 20 mm and ATG7KO+KA 20 mm; p = 0.0009 between control+KA 50 mm and ATG7KO+KA 50 mm. H, After-discharge threshold in control and ATG7KO mice subjected to kindling. UMD: −43.7 [95.0%CI −55.2, −32.8]; pt: 0.0. I, Representative epidural recordings of electrical activities in ipsilateral and contralateral sides. J, Numbers of stimulations needed to elicit contralateral activities in control and ATG7KO mice. Two-way ANOVA; group effect: F(30,30) = 7.336, p < 0.0001; number of stimulation effect: F(1,30) = 14.43, p = 0.0007. K, Representative EEG traces of animals that developed generalized seizures because of kindling. L, Numbers of stimulations needed to trigger generalized seizures in control and ATG7KO mice. Two-way ANOVA; group effect: F(30,30) = 5.3, p < 0.0001; number of stimulation effect: F(1,30) = 26.28, p < 0.0001. M, Average seizure duration in control and ATG7KO mice. UMD: 9.55 (95.0%CI −1.34, 19.0); pt = 0.0506.
- Figure 2.
The impact of ATG7 deletion on microglia. A, Full-montage images of Iba1+ cells in the cortical and hippocampal areas in control and ATG7KO mice. Scale bar: 200 μm. Green: anti-Iba1; blue: DAPI. B, Confocal images (25×) of microglia from the cortical (CTX) and hippocampal CA1, CA3, and DG regions of control and ATG7KO mice. Scale bar: 20 μm. Green: anti-Iba1; red: anti-CD68; blue: DAPI. C, Quantification of Iba1+ cells per 105 μm2 (n = 6; 3 M, 3 F). CTX: UMD: 0.789 (95.0%CI −3.81, 6.49); pt = 0.788. CA1: UMD: 1.35 (95.0%CI −3.65, 6.21); pt = 0.62. CA3: UMD: 0.617 (95.0%CI −2.59, 4.02); pt = 0.747. DG: UMD: 0.717 (95.0%CI −3.22, 6.28); pt = 0.797. D, Quantification of CD68+/Iba1+ cells per 105 μm2 (n = 6; 3 M, 3 F). CTX: UMD: 0.0233 (95.0%CI −0.0283, 0.0833); pt = 0.448. CA1: −0.009 (95.0%CI −0.0665, 0.0503); pt = 0.786. CA3: UMD: 0.0065 (95.0%CI −0.0418, 0.057); pt = 0.806. DG: UMD: −0.0133 (95.0%CI −0.0717, 0.04); pt = 0.68.
- Figure 3.
The impact of ATG7 deletion on microglial cytokines and phagocytosis. A, Cytokine expression in cortical tissue samples from control and ATG7KO mice (n = 6; 3M, 3F). IFNa: UMD: −0.292 [95.0%CI −0.684, 0.249]; pt: 0.301. IFNb: UMD: −0.0762 [95.0%CI −0.329, 0.118]; pt: 0.527. IFNg: UMD: is −0.0877 [95.0%CI −0.486, 0.165]; pt: 0.561. IL6: UMS: 0.0582 [95.0%CI −0.241, 0.392]; pt: 0.753. IL1b: UMD: 0.0473 [95.0%CI −0.568, 0.949]; pt: 0.835. TNFa: UMD: 0.0262 [95.0%CI −0.233, 0.28]; pt: 0.864. iNOS: UMD: −0.0356 [95.0%CI −0.35, 0.404]; pt: 0.834. B, Cytokine expression in hippocampal tissue samples from control and ATG7KO mice (n = 6; 3M, 3F). IFNa: UMD: 1.31 [95.0%CI 0.47, 1.99]; pt: 0.0154. IFNb: UMD: 0.525 [95.0%CI 0.153, 0.918]; pt: 0.0486. IFNg: UMD: 0.938 [95.0%CI 0.322, 1.56]; pt: 0.0148. IL6: UMS: 0.0553 [95.0%CI −0.0599, 0.174]; pt: 0.51. IL1b: UMD: 0.746 [95.0%CI 0.232, 1.7]; pt: 0.0142. TNFa: UMD: 2.01 [95.0%CI 0.878, 2.66]; pt: 0.0108. iNOS: UMD: 0.256 [95.0%CI 0.0246, 0.56]; pt: 0.118. C, Cytokine expression in purified microglial samples of control and ATG7KO mice (n = 6; 3M, 3F). IFNa: UMD: 1.13 [95.0%CI 0.828, 1.45]; pt: 0.0. IFNb: UMD: 1.16 [95.0%CI 0.697, 1.62]; pt: 0.0. IFNg: UMD: 0.973 [95.0%CI 0.703, 1.36]; pt: 0.0. IL6: UMS: −0.192 [95.0%CI −0.419, 0.0818]; pt: 0.164. IL1b: UMD: 0.541 [95.0%CI 0.334, 0.891]; pt: 0.0. TNFa: UMD: 0.683 [95.0%CI 0.211, 0.977]; pt: 0.0138. iNOS: UMD: 0.724 [95.0%CI 0.366, 1.16]; pt: 0.0002. D, Representative time series images (63×) showing in vitro uptake of pHrodo zymosan bioparticles (green) in microglia prepared from control and ATG7KO mice; Scale bar – 25 μm. E, Representative time-course showing the number of bioparticles taken up. F, Average particles per microglial cell at the 30- and 60-min time points (n = 4); 30 min: UMD: 0.25 [95.0%CI −0.75, 1.0]; pt: 0.365. 60 min: UMD: −0.5 [95.0%CI −1.5, 0.0]; pt: 0.112.
- Figure 4.
Impact of microglial ATG7 deletion on astrocytes and neurons. A, Full-montage images of GFAP expression in the cortical and hippocampal areas from littermate control and ATG7KO mice. Green: GFAP; Blue: DAPI. Scale bar – 200 μm. B, Full-scale images of NeuN expression in the cortical and hippocampal areas of littermate control and ATG7KO mice. Green: NeuN; Blue: DAPI. Scale bar – 200 μm. C, Confocal images (25×) of astrocytes from the cortical (CTX) and hippocampal CA1, CA3 and DG regions of littermate control and ATG7KO mice. Green: GFAP; Blue: DAPI. Scale bar – 20 μm. D, Confocal images of neurons from the cortical (CTX) and hippocampal CA1, CA3 and DG regions of littermate control and ATG7KO mice. Scale bar – 20 μm. E, Quantification of GFAP+ cells per 105 μm2. n = 6 (3 M, 3 F). CTX: UMD: −0.02 [95.0%CI −0.253, 0.26]; pt: 0.881. CA1: UMD: 0.3 [95.0%CI −3.35, 3.57]; pt: 0.886. CA3: UMD: −0.7 [95.0%CI −2.7, 1.43]; pt: 0.549. DG: UMD: −0.283 [95.0%CI −3.45, 2.9]; pt: 0.862. F, Quantification of NeuN+ cells per 105 μm2. n = 6 (3 M, 3 F). CTX: UMD: −36.0 [95.0%CI −1.91e+02, 1.44e+02]; pt: 0.708. CA1: UMD: 5.83 [95.0%CI −1.25e+02, 1.24e+02]; pt: 0.925. CA3: UMD: −61.7 [95.0%CI −2.12e+02, 75.5]; pt: 0.466. DG: UMD: 17.2 [95.0%CI −1.77e+02, 1.64e+02]; pt: 0.846.
- Figure 5.
Impact of microglial ATG7 deletion on expression of myelination markers. A, Representative images (20×) of corpus callosum (CC), cingulate cortex (CX) and striatum (ST) from littermate control and ATG7KO mice stained with MBP, MOG and PLP antibodies. B, Quantification of MBP, MOG and PLP expression in control and ATG7KO mice; n = 6 (3 M, 3 F). MBP: Corpus callosum (CC): UMD: 40.6 [95.0%CI 29.5, 48.8]; pt: 0.0016. Cortex (CTX): UMD: 52.9 [95.0%CI 40.7, 68.0]; pt: 0.0. Striatum (ST): UMD: 43.5 [95.0%CI 33.5, 50.5]; pt: 0.0. MOG: Corpus callosum (CC): UMD: 34.2 [95.0%CI 23.0, 46.4]; pt: 0.0002. Cortex (CTX): UMD: 41.3 [95.0%CI 30.3, 56.5]; pt: 0.0. Striatum (ST): UMD: 26.6 [95.0%CI 18.8, 33.2]; pt: 0.0. PLP: Corpus callosum (CC): UMD: 46.2 [95.0%CI 36.9, 53.6]; pt: 0.0. Cortex (CTX): UMD: 40.5 [95.0%CI 28.6, 52.4]; pt: 0.0006. Striatum (ST): UMD: 27.9 [95.0%CI 22.5, 34.3]; pt: 0.0004. C, Western blot analysis of MBP, MOG and PLP protein levels from whole brain and corpus callosum lysates; n = 6 (3 M, 3 F). D, Quantification of MBP, MOG and PLP protein levels from whole brain. MBP: UMD: 44.3 [95.0%CI 35.5, 56.9]; pt: 0.0004. MOG: UMD: 40.3 [95.0%CI 33.4, 48.8]; pt: 0.0002. PLP: UMD: 50.8 [95.0%CI 43.2, 57.3]; pt: 0.0006. E, Quantification of MBP, MOG and PLP protein levels from isolated corpus callosum lysates. MBP: UMD: 54.0 [95.0%CI 47.7, 62.7]; pt: 0.0. MOG: UMD: 42.2 [95.0%CI 34.3, 50.1]; pt: 0.0. PLP: UMD: 48.6 [95.0%CI 41.5, 55.2]; pt: 0.0.
- Figure 6.
Impact of microglial ATG7 deletion on oligodendrocytes. A–C, Representative confocal images (25×) of corpus callosum (CC) (A), cingulate cortex (CTX) (B) and striatum (ST) (C) from littermate control and ATG7KO mice stained with an oligodendrocyte marker (Olig2; green) and a marker of mature oligodendrocytes (CC-1; red). Scale bar – 20 μm, 5 μm. D–F, Quantification of Olig2+ cells, CC1+ cells and Olig2+/CC1+ cells per 0.5 mm2; n = 6 (3 M, 3 F). Oligo2+ cells (D): Corpus callosum (CC): UMD: 5.38e+02 [95.0%CI 4.13e+02, 6.58e+02]; pt: 0.0. Cortex (CTX): UMD: 3.14e+02 [95.0%CI 2.14e+02, 4.3e+02]; pt: 0.0. Striatum (ST): UMD: 1.78e+02 [95.0%CI 1.27e+02, 2.36e+02]; pt: 0.0. CC1+ cells (E): Corpus callosum (CC): UMD: 2.74e+02 [95.0%CI 1.32e+02, 3.87e+02]; pt: 0.0046. Cortex (CTX): UMD: 1.68e+02 [95.0%CI 88.7, 2.36e+02]; pt: 0.0024. Striatum (ST): UMD: 1.43e+02 [95.0%CI 1.01e+02, 1.79e+02]; pt: 0.0. Olig2+/CC1+ cells (F): Corpus callosum (CC): UMD: 4.49 [95.0%CI −2.21, 10.9]; pt: 0.245. Cortex (CTX): UMD: −2.26 [95.0%CI −5.52, 1.15]; pt: 0.254. Striatum (ST): UMD: 1.39 [95.0%CI −4.52, 6.48]; pt: 0.636. G, Western blot analysis of Olig2 protein levels in whole brain and isolated corpus callosum lysates. H, Quantification of Olig2 protein levels in whole brain and isolated corpus callosum lysates n = 6 (3 m and 3 f). Whole brain: Oligo2: UMD: 40.7 [95.0%CI 36.9, 45.1]; pt: 0.0. Corpus callosum (CC): Oligo2: UMD: 59.5 [95.0%CI 54.1, 68.5]; pt: 0.0.
- Figure 7.
Microglial deletion of ATG7 changes the size of the nodes of Ranvier. A, Representative confocal images (63×) of IHC staining for sodium channel Nav1.6 (red) and CASPR (green) in the corpus callosum (CC) and cortex (CTX) areas of littermate control and ATG7KO mice. Scale bar – 20 μm. B, C, Quantification of the average size of nodes in the CC (B) and CTX (C) in littermate control and ATG7KO mice. Data points were acquired from 6 pairs of animals (3 M, 3 F). Corpus callosum (CC): UMD: 0.188 [95.0%CI 0.148, 0.231]; pt: 0.0. Cingulate cortex (CTX): UMD: 0.141 [95.0%CI 0.0685, 0.211]; pt: 0.0. D, E, Distribution of the length of nodes in the corpus callosum (D) and cingulate cortex (E) of littermate control and ATG7KO mice.
Tables
Gene Sense (5'−3') Anti-sense (3'−5') Species TNF-α ATGGCCTCCCTCTCATCAGT GTTTGCTACGACGTGGGCTA Mouse IL-1β CGCAGCAGCACATCAACAAG GTGCTCATGTCCTCATCCTG Mouse IL6 ACCAGAGGAAATTTTCAATAGGC TGATGCACTTGCAGAAAACA Mouse IFN-α GGACTTTGGATTCCCGCAGGAGAAG GCTGCATCAGACAGCCTTGCAGGTC Mouse IFN-β TCCGAGCAGAGATCTTCAGGAA TGCAACCACCACTCATTCTGAG Mouse IFN-γ GCTCTGAGACAATGAACGCT AAAGAGATAATCTGGCTCTGC Mouse iNOS TGGAGCGAGTTGTGGATTGTC CCAGTAGCTGCCGCTCTCAT Mouse GAPDH GACAACTTTGGCATTGTGG ATGCAGGGATGATGTTCTG Mouse Gene Sense (5'−3') Anti-sense (3'−5') Species Cx3cr1 Cre+/− TTGCCTGCATTACCGGTCGAT GATCCTGGCAATTTCGGCTAT Mouse ATG7 flox - 373 bp ACAGTGCACATCCTGTTCCA CCAAAGGAAACCAAGGGAGT Mouse ATG7 flox - 243 bp GGACTTGTGCCTCACCAGAT CTCGTCACTCATGTCCCAGA Mouse TSC1 flow GTCACGACCGTAGGAGAAGC GAATCAACCCCACAGAGCAT Mouse Product Vendor Catalog Dilution RRID Anti-MOG Millipore MAB5680 IHC: 1:200
WB: 1:1000AB_1587278 Anti-MBP BioLegend 808401 IHC: 1:1000
WB: 1:1000AB_2564741 Anti-CC-1 CalBioChem OP80-100UG IHC: 1:300 AB_2057371 Anti-Olig2 Millipore AB9610 IHC: 1:200
WB: 1:2000AB_570666 Anti-PLP Abcam Ab28486 IHC: 1:500
WB: 1:1000AB_776593 Anti-p62 Cell Signaling 23214S IHC: 1:400
WB: 1:1000AB_2798858 Anti-NeuN Cell Signaling D4G4O IHC: 1:1000 AB_2651140 Anti-Iba1 Wako 019-19741 IHC: 1:400 AB_839504 Anti-CD68 Bio-Rad/AbD Serotec MCA1957 IHC: 1:400 AB_322219 Anti-GFAP Millipore AB5541 IHC: 1:300 AB_177521 Anti-GAPDH Cell Signaling 5174S WB: 1:1000 AB_10622025 Anti-mouse CD16/32 BioLegend 101302 Microglia purification: 1:50 AB_312801 PE anti-mouse CX3CR1 BioLegend 149006 Microglia purification: 1:50 AB_2564315 Anti-CASPR Neuromab Clone K65/35,
73-001IHC: 1:200 AB_10671175 Anti-NaV1.6 Alomone Labs ASC-001 IHC: 1:500 AB_2040003 Anti-mouse IgG, HRP conjugated Cell Signaling 7076S WB: 1:3000 AB_330924 Anti-rabbit IgG, HRP conjugated Cell Signaling 7074S WB: 1:3000 AB_2099233 Goat anti-Rabbit IgG (H + L) secondary antibody
Alexa Fluor 488 conjugateThermoFisher A-11034 IHC: 1:400 AB_257621 Goat anti-rabbit IgG (H + L) highly cross-adsorbed
secondary antibody, Alexa Fluor 568ThermoFisher A-11036 IHC: 1:400 AB_10563566 Goat anti-mouse IgG (H + L) highly cross-adsorbed
secondary antibody, Alexa Fluor 488ThermoFisher A-11001 IHC: 1:400 AB_2534069 Goat anti-mouse IgG (H + L) highly cross-adsorbed
secondary antibody, Alexa Fluor 568ThermoFisher A-11031 IHC: 1:400 AB_144696 Goat anti-rat IgG (H + L) cross-adsorbed secondary
antibody, Alexa Fluor 555ThermoFisher A-21434 IHC: 1:400 AB_2535855 Goat anti-chicken IgY (H + L) cross-adsorbed
secondary antibody, Alexa Fluor 488ThermoFisher A-11039 IHC: 1:400 AB_142924 Goat anti-guinea pig IgG (H + L) cross-adsorbed
secondary antibody, Alexa Fluor 568ThermoFisher A-11075 IHC: 1:400 AB_141954 Product Vendor Catalog no. RRID Neg-50 ThermoScientific 6502 Fluoromount G SouthernBiotech 0100-01 DAPI Sigma-Aldrich D9542-1MG DMEM Corning 10013-CV Phenol red-free DMEM Life technologies 31053-028 DMEM/F12 Gibco 11039-021 Mouse M-CSF Shenandoah 200-08 Percoll GE Healthcare 17-0891-01 Papain Sigma P3125 Dispase II Stemcell 07913 DNase I Sigma D4263 Bovine serum albumin Sigma A7030 Fetal bovine aerum Atlanta Biologicalalals S11150H Penicillin/streptomycin Cellgro 30-008-CI Poly-D-lysine Sigma P6407-5MG PowerUP SYBR Green Master Mix ThermoFisher A25777 TRIzol Life Technologies 15596018 Verso cDNA synthesis kit ThermoFisher AB1453B Pierce BCA Protein Assay kit ThermoScientific 23225 Chemiluminescent Substrate ThermoScientific 34580 pHrodo Green Zymosan Bioparticles Conjugate for Phagocytosis ThermoFisher P35365 Falcon 40 μm Cell Strainer Corning 352340 Preseparation Filters (30 μm) Miltenyi 130-041-407 MS Columns Miltenyi 130-042-201 Pilocarpine Sigma P6503 Product Developer Webpage ImageJ NIH https://imagej.nih.gov/ij/ GraphPad Prism 7.0 GraphPad Software https://graphpad.com ZEN Black Zeiss https://zeiss.com ZEN Blue Zeiss https://zeiss.com Sirenia Acquisition Pinnacle Technologies, Inc. https://www.pinnaclet.com/sirenia.html Neurolucida MBF Bioscience https://mbfbioscience.com Imaris Bitplane https://imaris.oxinst.com/
In this issue
