Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT

User menu

Search

  • Advanced search
eNeuro

eNeuro

Advanced Search

 

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT
PreviousNext
Research ArticleResearch Article: New Research, Development

Early-Life m6A RNA Demethylation by Fat Mass and Obesity-Associated Protein (FTO) Influences Resilience or Vulnerability to Heat Stress Later in Life

Tatiana Kisliouk, Tali Rosenberg, Osher Ben-Nun, Mark Ruzal and Noam Meiri
eNeuro 17 June 2020, 7 (3) ENEURO.0549-19.2020; DOI: https://doi.org/10.1523/ENEURO.0549-19.2020
Tatiana Kisliouk
1The Institute of Animal Science, Agricultural Research Organization, The Volcani Center, Rishon LeZion, Israel 7505101
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tali Rosenberg
1The Institute of Animal Science, Agricultural Research Organization, The Volcani Center, Rishon LeZion, Israel 7505101
2The Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot, Israel 761001
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Osher Ben-Nun
1The Institute of Animal Science, Agricultural Research Organization, The Volcani Center, Rishon LeZion, Israel 7505101
2The Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot, Israel 761001
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mark Ruzal
1The Institute of Animal Science, Agricultural Research Organization, The Volcani Center, Rishon LeZion, Israel 7505101
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Noam Meiri
1The Institute of Animal Science, Agricultural Research Organization, The Volcani Center, Rishon LeZion, Israel 7505101
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Noam Meiri
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Visual Abstract

Figure
  • Download figure
  • Open in new tab
  • Download powerpoint

Abstract

Early life heat stress leads to either resilience or vulnerability to a similar stress later in life. We have previously shown that this tuning of the stress response depends on neural network organization in the preoptic anterior hypothalamus (PO/AH) thermal response center and is regulated by epigenetic mechanisms. Here, we expand our understanding of stress response establishment describing a role for epitranscriptomic regulation of the epigenetic machinery. Specifically, we explore the role of N6-methyladenosine (m6A) RNA methylation in long-term response to heat stress. Heat conditioning of 3-d-old chicks diminished m6A RNA methylation in the hypothalamus, simultaneously with an increase in the mRNA levels of the m6A demethylase, fat mass and obesity-associated protein (FTO). Moreover, a week later, methylation of two heat stress-related transcripts, histone 3 lysine 27 (H3K27) methyltransferase, enhancer of zeste homolog 2 (EZH2) and brain-derived neurotrophic factor (BDNF), were downregulated in harsh-heat-conditioned chicks. During heat challenge a week after conditioning, there was a reduction of m6A levels in mild-heat-conditioned chicks and an elevation in harsh-heat-conditioned ones. This increase in m6A modification was negatively correlated with the expression levels of both BDNF and EZH2. Antisense “knock-down” of FTO caused an elevation of global m6A RNA methylation, reduction of EZH2 and BDNF mRNA levels, and decrease in global H3K27 dimethylation as well as dimethyl H3K27 level along BDNF coding region, and, finally, led to heat vulnerability. These findings emphasize the multilevel regulation of gene expression, including both epigenetic and epitranscriptomic regulatory mechanisms, fine-tuning the neural network organization in a response to stress.

  • chick
  • epigenetics
  • epitranscriptomics
  • FTO
  • hypothalamus
  • thermoregulation

Significance Statement

Exposure to different levels of stress during the critical period of thermal-control establishment confers future vulnerability or resilience and depends on epigenetic regulation. Tuning the stress-response set-point is crucial because of its implications for psychopathologies. Here, we demonstrate a cross talk between the epitranscriptomic and epigenetic systems in stress response establishment. Specifically, early-life heat conditioning diminished N6-methyladenosine (m6A) RNA methylation in the hypothalamus, simultaneously with an increased expression of the m6A demethylase, fat mass and obesity-associated protein (FTO). Antisense “knock-down” of FTO resulted in heat vulnerability. Moreover, this dual-level regulation is also demonstrated on brain-derived neurotrophic factor (BDNF) expression in heat stress, including m6A marks on BDNF transcript and H3K27me2 modifications on the BDNF gene. Cross talk between epigenetic and epitranscriptomic regulation can balance the response to future heat challenges.

Introduction

The exposure to stressful experiences, including heat stress, during the critical sensory development period at early life can change neural architecture and modulate the stress response set point leading to either stress resilience or vulnerability later in life (Franklin et al., 2012; Braun et al., 2017; van Bodegom et al., 2017; Lux, 2018). Thermal control set point is regulated by thermosensitive neurons of the preoptic anterior hypothalamus (PO/AH; Boulant, 2006; Wang et al., 2019). Thermal input during the critical period of thermal‐control establishment causes a plastic change in the ratio between thermosensitive neurons and innate PO/AH cells and can modulate temperature tolerance (Tzschentke and Basta, 2002). In chicks, the critical period of thermal-control establishment is between days 3 and 5 posthatch (Yahav and Hurwitz, 1996). Chicks exposed to moderate heat conditioning on day 3 posthatch displayed heat resilience during heat challenge on day 10, whereas chicks conditioned at high ambient temperature were vulnerable to heat stress (Kisliouk et al., 2014, 2017; Cramer et al., 2015, 2019). We have previously shown that epigenetic mechanisms, such as DNA methylation, histone modifications, and miRNAs, mediate the long-term effect of these stressful experiences in driving experience-dependent gene expression in the AH, underlying the heat stress memory formation (Yossifoff et al., 2008; Kisliouk and Meiri, 2009; Kisliouk et al., 2010, 2011, 2014, 2017; Cramer et al., 2015, 2019). Recent evidence suggests additional, epitranscriptomic level of regulation, conferring further flexibility to fine-tune gene expression on top of the epigenetic one (Cao et al., 2016; Roignant and Soller, 2017; Widagdo and Anggono, 2018; Shi et al., 2019). Like the epigenetic code surrounding DNA, RNA modifications located in coding sequences of mRNAs can influence the fate of RNA and thereby serve as potential regulators of mRNA expression (Gilbert et al., 2016; Nainar et al., 2016). N6-methyladenosin (m6A) is the most abundant and the best-characterized internal mRNA modification playing an important regulatory role in various aspects of mRNA metabolism including the splicing, nuclear export, transcription, translation, and decay (Cao et al., 2016; Gilbert et al., 2016; Roignant and Soller, 2017; Widagdo and Anggono, 2018). Majority of m6A methylation on mRNA is installed by a methyltransferase complex including methyltransferase-like 3 and 14 (METTL3 and METTL14) and removed by the demethylases, fat mass and obesity-associated protein (FTO), and ALKB homolog 5 (ALKBH5; Roignant and Soller, 2017; Widagdo and Anggono, 2018; Du et al., 2019; Shi et al., 2019). Cellular functions of m6A modification are exerted by its direct recognition by m6A-specific binding proteins including YTH-domain containing proteins, heterogeneous nuclear ribonucleoprotein (HNRNP), and common RNA binding proteins like IGF2BP1-3 and FMR1(Du et al., 2019; Shi et al., 2019). The m6A RNA modification is highly distributed in the brain (Meyer et al., 2012; Chang et al., 2017), and it was found to be essential regulatory element in various biological processes concerning neural development (Li et al., 2017; Yoon et al., 2017), synaptic plasticity (Chang et al., 2017; Merkurjev et al., 2018; Yu et al., 2018a), neurodegeneration (Li et al., 2018; Chen et al., 2019b), and axon regeneration (Weng et al., 2018). Imbalanced m6A RNA methylation was shown to affect diverse brain physiological functions, including learning, and memory (Widagdo et al., 2016; Walters et al., 2017; Shi et al., 2018; Zhang et al., 2018), addiction and reward (Hess et al., 2013; Ruud et al., 2019), and stress response (Engel et al., 2018). Here, we suggest a role for m6A RNA methylation in chick AH in long-term regulation of heat stress response.

Materials and Methods

Bird housing

Male Cobb chicks were obtained on the first day of life from Brown Hatcheries and raised in climate-controlled rooms at 30°C under continuous artificial illumination with ad libitum access to food and water. All experiments were performed according to the guidelines of the European Community Council and approved by the Volcani Institute Committee for Animal Use in Research.

Heat treatment and tissue collection

Heat conditioning was performed on day 3 posthatch. The chicks were arbitrarily divided into two groups and transferred into either 36°C or 40°C preheated rooms for 24 h, giving “mild-temperature-conditioned chicks” and “high-temperature-conditioned chicks,” respectively. Body temperature was measured for each group of chicks using a digital thermometer (Extech Instruments) with ±0.1°C accuracy that was inserted 1.5 cm into the cloaca. Chicks were killed by decapitation 6 and 24 h into the thermal treatment conditioning. Non-treated age-matched chicks served as controls. The brain areas matching the AH, the mesopallium intermediomediale (IMM), and the frontal area of the brain (FB; schematically represented in Fig. 1B) were dissected from the whole brain. In brief, the skull was cut along the λ suture and the sagittal suture, the brain was removed from the skull and set on a small plastic cube with the lateral side upwards. First, the AH was dissected. The boundaries of the dissections were determined by the optic chiasma and the clear boundaries of the hypothalamus (A 8–10 L 0–1.4 on both hemispheres coordinates according to Kuenzel, 1988). After dissection, the tissues were immediately immersed in RNALater (Ambion).

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Effect of heat stress on global m6A RNA methylation in the AH. A, Schematic diagram of the experimental setup. The chicks were heat‐conditioned on day 3 at moderate (36°C) or extreme (40°C) ambient temperatures for 24 h. One week after (day 10), the chicks were challenged by exposure to 36°C for 6 h. Chicks were killed at 6 and 24 h into heat conditioning and at 0 and 6 h into heat challenge. Dissected brain subregions were analyzed. B, Illustrative diagram demonstrating the dissection of the brain area matching the AH, mesopallium IMM and FB. C, Absolute amount (%) of m6A in total RNA during heat conditioning on day 3. Total RNA was isolated from the AH of 3-d-old naive chicks at 6 h into the treatment and subjected to quantification of global m6A RNA methylation. Results are mean ± SEM of 15–17 chicks in each group (F(2,44) = 3.39; p = 0.043; one‐way ANOVA; Tukey’s HSD test). D, E, FTO mRNA expression during heat conditioning on day 3. Total RNA was isolated from the AH (D) and FB and IMM (E) at indicated time points. FTO mRNA expression was evaluated by Syber green real‐time PCR. HMBS was used as a standard gene. The relative mRNA expression in naive chicks was set to 1. Each value is the mean ± SEM of 10–23 individual chicks (F(4,103) = 2.870; p = 0.026; one‐way ANOVA; Dunnett’s multiple comparisons test relative to naive). F, FTO mRNA expression in AH throughout the first week postconditioning. Total RNA was isolated from the AH 1, 2, 3, and 7 d following heat conditioning (recovery) and subjected to Syber Green real‐time PCR. Each value is the mean ± SEM of 10–30 individual chicks normalized to that of naive age-matched chicks (recovery effect F(4,134) = 7.156, p < 0.0001; conditioning effect F(4,134) = 0.176, p = 0.676; interaction F(4,134) = 0.371, p = 0.829; two-way ANOVA; Dunnett’s multiple comparisons test relative to 24 h). G, FTO mRNA expression in AH during heat challenge on day 10. Non-conditioned chicks (non-cond) and chicks that were exposed to moderate (36°C; 36°C-cond) or extreme (40°C; 40°C-cond) ambient temperature on day 3 posthatch were re‐exposed to moderately high ambient temperature of 36 ± 0.5°C a week later. Total RNA was isolated from the AH before, and at 6 h into the challenge. FTO mRNA expression was evaluated by Syber Green real‐time PCR. Each value is the mean ± SEM of 20–30 individual chicks normalized to the respective control at 0 h, which was set to 1. H, Absolute amount (%) of m6A in total RNA during heat challenge on day 10. Total RNA was isolated from the AH of 10-d-old naive (non-cond), 36°C-conditioned (36°C-cond) and 40°C-conditioned (40°C-cond) chicks, before, and at 6 h into the challenge. Each bar represents average m6A RNA methylation percentage of 10–23 individual chicks (conditioning effect F(2,96) = 2.689, p = 0.073; challenge effect F(1,96) = 2.869, p = 0.093; interaction F(2,96) = 2.366, p = 0.099; two-way ANOVA; Fisher’s LSD multiple comparisons test); * indicates significant difference from naive; # indicates significant difference from 24-h conditioning along the recovery period; + indicates significant difference between 0 and 6 h into heat challenge.

Heat challenge was performed on day 10 posthatch. Both experimental chick groups and their naive counterparts were thermally challenged by exposure to 36°C for 6 h. The chicks were measured for body temperature and killed by decapitation at 0 and 6 h into the heat challenge. The brain subregions AH, IMM, and FB were dissected and immersed in RNALater.

Total RNA isolation and real‐time PCR

Total RNA was isolated with Total RNA Purification Plus kit (Norgen Biotek) according to the manufacturer’s instructions. Isolated RNA (0.5 μg) was reverse transcribed to single‐stranded cDNA by SuperScript II Reverse Transcriptase and oligo(dT) plus random primers (Invitrogen). Real‐time PCR was performed with 10‐ng cDNA in a StepOnePlus Real Time PCR System (Applied Biosystems) with PerfeCta SYBR Green FastMix, ROX (Quanta BioSciences). Dissociation curves were analyzed following each real‐time PCR to confirm the presence of only one product and the absence of primer dimer formation. The threshold cycle number (Ct) for each tested gene (X) was used to quantify the relative abundance of that gene using the formula 2 (Ct gene X – Ct standard). Hydroxymethylbilane synthase (HMBS) was used as the standard for mRNA expression. The primers used for real‐time PCR were as follows (5′→3′): HMBS, F‐CGTTTGGAGGGTGGCTGTAG, R‐TGTCAAGTACAACTGGCCATCTTT; FTO, F-TAACATGCCTCTGCCACTTG, R-GGCTGGAAGGTGACCTGATA; enhancer of zeste homolog 2 (EZH2), F‐CACTGAACAGCAGCTTCCAGG, R‐AAGAATGCAGGCTTTGCTCC; BDNF, F‐GCTTGGCTTACCCAGGTCTTC, R‐TCAAAAGTGTCCGCCAGTG; heat-shock protein70 (HSP70; HSPA2), F‐TGGGTGTCTTCCAGCATGG, R‐GATGAGGCGCTCTGTATCGG.

Quantification of global m6A RNA methylation

Total RNA was isolated with Total RNA Purification Plus kit (Norgen Biotek). The purified RNA (200 ng of each sample) was processed for detecting m6A RNA methylation status using the EpiQuik m6A RNA Methylation Quantification Colorimetric kit (EpiGentek) according to the manufacturer’s instructions. The detected signal was quantified colorimetrically by reading the absorbance at 450 nm (Infinite M200 PRO microplate plate reader, Tecan). The absolute percentage of m6A in total RNA was calculated using a standard curve prepared from the samples with known amount of m6A.

m6A RNA immunoprecipitation (m6A-RIP)

The m6A- RIP protocol was adopted from the method described by Dominissini et al. (2013) with several modifications. Purified RNA (20 μg) of two chicks within the same treatment was pooled and shared to ∼100 nucleotide fragments with Magnesium RNA fragmentation Module (New England Biolabs) at 94°C for 5 min. Fragmented RNA was incubated with 20 μl of Magna ChIP Protein A + G magnetic beads (Millipore) precoated with 2 μg of anti-m6A antibody (Abcam) or mouse IgG (Millipore; used as background RIP) in RIP buffer (150 mm NaCl, 10 mm TRIS-HCl, and 0.1% NP-40) supplemented with RNasin Plus (Promega) for 2 h at 4°C. The beads were washed three times with RIP buffer, and m6A RNA was eluted twice with RIP buffer including 20 mm of m6A 5’-monophosphate sodium salt (Cayman Chemical). The samples were cleaned up by ethanol precipitation, and 70 ng of each sample was reverse transcribed to single‐stranded cDNA. The m6A enrichment was determined by real-time PCR using the primers mentioned in the upper paragraph.

FTO‐antisense “knock-down”

An antisense oligodeoxyribonucleotide was designed to hybridize to the AUG translation initiation codon of the mRNA encoding FTO. A blast search revealed no significant homology to any sequence in GenBank other than the FTO sequence. The antisense and sense sequences were 5′‐ C*C*TGCTCTCCTCTTCATGC*T‐3′ and 5′‐ A*G*CATGAAGAGGAGAGCAG*G‐3′, respectively. The oligodeoxyribonucleotides were protected by double‐phosphorothiolation at both the 3′‐end and 5′‐end (* represents protected nucleotides) and were purified by high‐performance liquid chromatography (Sigma-Aldrich). Both oligonucleotides were dissolved in saline to a final concentration of 1 μg/μl. FTO‐antisense or FTO‐sense (2.5 μg) was injected into the third ventricle of 3‐d‐old chicks, as previously described (Kisliouk and Meiri, 2009). The effectiveness of FTO‐antisense inhibition was evaluated by measuring of chick body temperature, FTO mRNA levels, and quantification of global m6A RNA methylation in the AH at 2, 6, and 24 h after injection.

Both groups of injected chicks were kept at a constant temperature of 30°C until day 10, when they subjected to heat challenge by exposure to 36°C for 6 h. Their AH was dissected and immediately immersed in RNALater for RNA and protein isolation. The changes in chick body temperature were evaluated before and at the end of heat challenge.

Western blot analysis

For Western blot analysis proteins of the AH were extracted with sodium dodecylsulfate (SDS) lysis buffer (25 mm Tris–HCl, pH 6.8, 2.3% SDS, 10% glycerol, and 5%β‐mercaptoethanol). Protein extracts were separated on a 7–12% SDS-polyacrylamide gel and transferred to nitrocellulose membranes. The membranes were blocked in Tris-buffered saline with Tween 20 (20 mm Tris, pH 7.4, 150 mm NaCl, and 0.05% Tween 20) containing 5% skim milk (Sigma) for 1 h at room temperature and incubated overnight with anti-rabbit EZH2 (1:1000; Cell Signaling Technology), anti-rabbit β-actin (1:2000; Cell Signaling Technology), anti‐rabbit H3K27me2 (1:2000; Millipore), or anti‐rabbit H3K27me3 (1:2000; Millipore) antibodies at 4°C. The membranes were washed and then incubated with anti-rabbit IgG horseradish peroxidase-conjugated antibody (1:5000; GE Healthcare) at room temperature for 1 h. A chemiluminescent signal was detected using SuperSignal West Pico chemiluminescent substrate (Pierce Biotechnology) by the G:BOX chemi XRQ gel-imaging system (Syngene, Synoptics Ltd.), and densitometric analysis was performed using Quantity One 1-D analysis software (Bio-Rad).

Chromatin immunoprecipitation (ChIP) assays

Anterior hypothalamic tissues were crosslinked with 1% formaldehyde for 10 min and then sonicated in cell lysis buffer (1% SDS, 10 mm EDTA, and 50 mm Tris; pH 8.1) supplemented with protease inhibitor cocktail from Cell Signaling Technology for nine rounds of 10 pulses each using a Vibracell Sonix (maximal power 750W; Sonics & Materials Inc.) at 30% maximal power to obtain fragments of 200–1000 bp. Sheared chromatin samples were diluted in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris-HCl, pH 8.1, 167 mm NaCl, and protease inhibitor cocktail) and incubated with anti-H3K27me2 antibody or mouse IgG as background IP (each 3 μg/sample; Millipore) overnight at 4°C. Immunoprecipitates were separated by Magna ChIP Protein A + G magnetic beads (20 μl/sample; Millipore) for 2 h at 4°C and reverse crosslinked in ChIP elution buffer [1% SDS, 100 mm NaHCO3, 0.2 m NaCl, and proteinase K (50 μg/sample)] for 2 h at 62°C. DNA was isolated from each immunoprecipitate with Simple ChIP DNA Purification Buffers and Spin Columns (Cell Signaling Technology) and subjected to real-time PCR using BDNF primers aligning at the following positions: −869 to −801 bp upstream of the coding region, F‐TGGTTTTCATGAGGAGCCCT and R‐TTTCCCAGAGCCCCATATCA; and +91 to +190 bp into the coding region (for sequences see previous section) and +1623 to +1698 bp [located at the 3′‐untranslated region (3′‐UTR)], F‐GTCCCCTCCCCTTTCCTCTC and R‐CAAGCTCCAGTTGTATGCTGAGTG. The data were normalized to an input control that consisted of PCRs from 1% crosslinked chromatin before immunoprecipitation.

Statistical analysis

Data were analyzed using IBM SPSS statistics (version 20, Statistical Package for the Social Sciences) and GraphPad Prism 6 software (GraphPad Software). No animals were excluded from the experiments or statistical analysis. Statistical power analysis was not applied for sample sizes determination. Nevertheless, the sample size was determined on the basis of previous studies (Kisliouk et al., 2014; Cramer et al., 2015). Sample number (N) includes the number of individual chicks in each treatment group. Data are presented as mean ± SEM. The Shapiro–Wilk W test was used to examine the distribution. When the distribution was normal, i.e., Shapiro–Wilk W test gave a significance p > 0.05, parametric tests such as two-way ANOVA (for multiple effects and their interaction), Student’s t test (for two separate comparisons), or one‐way ANOVA (for multiple comparisons) were used. Tukey’s HSD test, Dunnett’s, or Fischer’s LSD tests were run for multiple comparisons, according to the data. Differences were considered significant at p < 0.05. The statistic values are indicated in figure legends.

Results

Heat stress reduces global m6A RNA methylation in the AH

To test whether acute heat stress influences m6A RNA methylation, 3-d-old chicks were conditioned at either 36°C or 40°C (Fig. 1A). These temperatures were chosen because they have been shown to induce heat resilience or vulnerability, respectively, later in life (Cramer et al., 2015). As demonstrated in Figure 1C, global m6A RNA methylation was reduced in the AH of 3-d-old chicks in a temperature‐dependent manner, with significant decrease (∼25%; p = 0.043) at 6 h into the high-temperature (40°C) conditioning. The decrease in m6A RNA levels during heat conditioning was inversely correlated with FTO mRNA expression in the AH: after 6 h of heat conditioning at 40°C, the expression level of FTO mRNA was 1.5-fold higher than that in naive chicks (p = 0.034), whereas a 1.3-fold increasing trend in FTO mRNA expression was measured at the same time in 36°C-conditioned chicks (Fig. 1D). At the end of conditioning (24 h), FTO expression reached to its maximum level (∼1.5-fold trend) and ∼1.7 increase (p = 0.016) in 36°C- and 40°C-conditioned chicks, respectively, compared with naive chicks (Fig. 1D). To assess regional specificity concerning m6A RNA methylation in response to heat stress, FTO mRNA levels were also evaluated in two additional brain areas, FB and IMM (Fig. 1B), at 6 h into the 40°C conditioning. As a result of heat exposure, in contrast to the expression in the AH, there was no change in FTO mRNA expression in either of these two areas (Fig. 1E). FTO mRNA expression in the AH of both conditioned groups gradually declined after the end of the heat conditioning (recovery effect p < 0.0001; two-way ANOVA; Fig. 1F). During recovery on the first day postconditioning (day 4 posthatch), FTO mRNA levels in 40 and 36°C-conditioned chicks tended to be 1.4- and 1.2-fold higher than those in naive age-matched chicks (Fig. 1F). However, from the second to seventh day postconditioning (days 5–10 posthatch), FTO mRNA expression significantly decreased in 40°C-conditioned chicks (p = 0.028, p = 0.039, and p = 0.0002 on recovery days 2, 3, and 7, respectively). FTO mRNA levels in 36°C-conditioned during recovery period presented similar dynamics (p = 0.029 on recovery day 7). It should be noted that no interaction was found between the effect of heat conditioning and heat recovery measured from the second to seventh day postconditioning. Moreover, heat challenge on day 10 did not significantly affect FTO mRNA levels in both conditioned chick groups as well as in 10-d-old naive chicks (Fig. 1G). The general effects of heat conditioning and heat challenge on global m6A RNA levels in the AH evaluated by two-way ANOVA had a trend toward significance. However, by the LSD post hoc test, one week after heat conditioning, global m6A RNA levels in the AH of both groups of conditioned chick were lower, by approximately 30% and 40% for 36°C- and 40°C-conditioned chicks, respectively, than those of naive age-matched counterparts (p = 0.005 and p = 0.0006 for 36°C- and 40°C-conditioned chicks, respectively; 0 h; Fig. 1H). Moreover, m6A RNA methylation in the AH was not further altered in both conditioned chick groups at 6 h into heat challenge (Fig. 1H). Interestingly, exposure to heat stress of 10-d-old naive chicks, similarly to the heat conditioning on day 3 posthatch, resulted in reduction (∼35%; p = 0.01) of global m6A RNA methylation, (Fig. 1H). The m6A RNA levels of 10-d-old non-conditioned chicks after 6 h of heat challenge were similar to those of conditioned age-matched chicks (Fig. 1H). These data indicate that acute heat stress, independent of age, leads to decrease in global m6A RNA methylation in the AH.

M6A RNA methylation profile of EZH2 and BDNF in the AH of harsh-temperature-conditioned chicks is opposite to that of mild-heat-conditioned ones

Based on the fact that alterations in global m6A RNA methylation reflect the changes in m6A level along total RNA, including all the RNA in a cell, we aimed to identify m6A methylation along specific transcripts in correlation with heat stress. As potential candidates were chosen EZH2, BDNF, and HSP70, because their role in both thermal control establishment and heat stress response was previously demonstrated (Kisliouk and Meiri, 2009; Kisliouk et al., 2017). We analyzed m6A levels along EZH2, BDNF, and HSP70 transcripts at their coding region by m6A-RIP followed by PCR. A strong interaction between heat conditioning and challenge was determined by two-way ANOVA (p = 0.026 for EZH2, p = 0.004 for BDNF; Fig. 2A,B). A week after heat conditioning (0 h into heat challenge), m6A levels along both EZH2 and BDNF transcripts in the AH were 40% and 35% lower [p = 0.06 for EZH2 (Fig. 2A) and p = 0.04 for BDNF (Fig. 2B)], respectively, in 40°C‐conditioned chicks than those in their 36°C‐conditioned counterparts. However, when heat challenged, the m6A levels in the AH were opposite between harsh- and mild-heat-conditioned chicks. While a 6‐h heat challenge of the 40°C‐conditioned chicks resulted in 2- and 1.8-fold increase in m6A levels at EZH2 and BDNF transcripts, respectively (p = 0.037 for EZH2 and p = 0.005 for BDNF; Fischer’s LSD), a 6‐h heat challenge of the 36°C‐conditioned chicks led to decrease in methylation of both transcripts (1.7- and 1.6-fold decrease of EZH2 and BDNF, respectively; p = 0.076 for EZH2 and p = 0.049 for BDNF; Fischer’s LSD; Fig. 2A,B). No changes in m6A RNA methylation were detected in the AH of the same samples at HSP70 during heat challenge (Fig. 2C). It should be noted that exposure to heat of 10-d-old non-conditioned chicks did not affect m6A levels at EZH2, BDNF, and HSP70 transcripts in the AH (Fig. 2A–C). Since the amount of mRNA in the cell might depend on the level of m6A RNA methylation, we also analyzed EZH2, BDNF, and HSP70 mRNA expression in the AH during heat challenge on day 10 posthatch. An interaction between heat conditioning and challenge on EZH2, BDNF, and HSP70 mRNA expression was evaluated by two-way ANOVA (p = 0.056 for EZH2, p = 0.084 for BDNF, and p = 0.032 for HSP70; Fig. 2D–F). As depicted in Figure 2D,E, EZH2 and BDNF mRNA baseline expression (0 h into heat challenge) in the AH was not affected by either harsh or moderate heat conditioning and was not different from that of non-conditioned age-matched chicks. However, the levels of both transcripts at 6 h into the heat re‐exposure were reduced by 35 and 30%, respectively, comparing with those before the heat challenge [p = 0.0002 for EZH2 mRNA (Fig. 2D) and p = 0.023 for BDNF mRNA, Fischer’s LSD (Fig. 2E)]. Heat challenge (6 h) of 36°C‐conditioned chicks as well as non-conditioned counterparts had no significant effect on the mRNA expression of both EZH2 and BDNF in the AH (Fig. 2D,E). As expected (Kisliouk et al., 2017), the HSP70 mRNA expression during heat challenge was the highest in chicks conditioned under harsh ambient temperature: at 6 h into the challenge, HSP70 mRNA level in 40°C‐conditioned chicks was >1.3 times higher than that in non-conditioned chicks (p = 0.002) and almost two times higher than that in the 36°C-conditioned counterparts (p < 0.0001; Fischer’s LSD; Fig. 2F). These data imply on a role for m6A RNA signature on transcript-specific regulation of gene expression, specifically, an increase in m6A RNA levels negatively correlated with the mRNA expression. To confirm the AH regional specificity of m6A RNA methylation profile, m6A levels at EZH2, BDNF, and HSP70 transcripts were also evaluated in FB and IMM during heat challenge of 10-d-old 40°C‐conditioned chicks and their non-conditioned counterparts. There were no changes detected in m6A levels at EZH2, BDNF, and HSP70 transcripts in either of these two areas before (0 h) and at 6 h into heat challenge (Fig. 2G–L).

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Long-term effect of heat stress on m6A methylation of EZH2, BDNF, and HSP70 transcripts in the AH. A–C, m6A enrichment along the EZH2 (A), BDNF (B), and HSP70 (C) transcripts in the AH during heat challenge on day 10. Total RNA was isolated from the AH of 10-d-old chicks before (0 h) and 6 h into heat challenge and then subjected to m6A-RIP with anti-m6A antibody followed by real-time PCR. The levels of EZH2, BDNF, and HSP70 mRNA in the RIP samples were normalized against the HMBS ones (EZH2 m6A-IP, BDNF m6A-IP, and HSP70 m6A-IP, specifically). Each value is the mean ± SEM of 9–13 pools of the two chicks normalized to that of non-conditioned chicks (non-cond) at 0 h, which was set to 1. For EZH2 m6A-IP conditioning effect F(2,54) = 0.111, p = 0.89; challenge effect F(1,54) = 0.045, p = 0.83; interaction F(2,54) = 3.885, p = 0.026; two-way ANOVA. For BDNF m6A-IP conditioning effect F(2,54) = 0.297, p = 0.74; challenge effect F(1,54) = 0.102, p = 0.75; interaction F(2,54) = 6.196, p = 0.004; two-way ANOVA. Fisher’s LSD multiple comparisons tests: # significant difference between 36°C‐ and 40°C‐conditioned chicks (36°C-cond and 40°C-cond, respectively); * significant difference relative to respective control (0 h). D–F, mRNA levels of EZH2 (D), BDNF (E), and HSP70 (F) in the AH during heat challenge on day 10. Total RNA from the AH of the same samples described in A–C was subjected to real‐time PCR with EZH2 (D), BDNF (E), and HSP70 (F) primers, respectively. HMBS mRNA expression was used as the standard. Results are mean ± SEM of 20–25 chicks in each group. The PCR relative value of non-conditioned chicks at 0 h was set to1. For EZH2 mRNA conditioning effect F(2,129) = 2.97, p = 0.055; challenge effect F(1,129) = 10.47, p = 0.001; interaction F(2,129) = 2.98, p = 0.054; two-way ANOVA. For BDNF mRNA conditioning effect F(2,128) = 2.49, p = 0.086; challenge effect F(1,128) = 0.861, p = 0.35; interaction F(2,128) = 2.515, p = 0.085; two-way ANOVA. For HSP70 mRNA conditioning effect F(2,129) = 14.06, p < 0.0001; challenge effect F(1,129) = 158, p < 0.001; interaction F(2,129) = 3.54, p = 0.032; Fisher’s LSD multiple comparisons tests: * significant difference relative to respective control (0 h); # significant difference in HSP70 mRNA level between 36°C‐ and 40°C‐cond at 6 h into the challenge. G–I, m6A enrichment along the EZH2 (G), BDNF (H), and HSP70 (I) transcripts in the FB during heat challenge on day 10. J–L, m6A enrichment along the EZH2 (J), BDNF (K), and HSP70 (L) transcripts in the IMM during heat challenge on day 10. Total RNA isolated from the FB (G–I) and IMM (J–L) was subjected to m6A-RIP with anti-m6A antibody followed by real-time PCR as described in A–C. Each value is the mean ± SEM of six pools of the two chicks normalized to that of non-conditioned chicks (non-cond) at 0 h, which was set to 1.

FTO-antisense knock-down alters EZH2 and BDNF mRNA levels in the AH

To explore whether an increase in the m6A RNA methylation down-regulates EZH2 and BDNF mRNA levels, and furthermore, affects heat stress response, FTO-antisense DNA was intracranially injected into the third ventricle of 3‐d‐old chicks (Fig. 3A). The time course of inhibition was determined by measuring the FTO mRNA levels in the AH between 2 and 24 h after the injection and comparing them with those in chicks injected with FTO‐sense‐specific sequence (Fig. 3B). As depicted in Figure 3B, a 35% inhibition of FTO mRNA (p = 0.016) was observed at 6 h after injection, at 24 h after the antisense treatment, FTO mRNA levels were similar to those in sense‐treated chicks. Since inhibition of FTO mRNA expression is expected to lead to increase in m6A modification, we also evaluated global m6A RNA methylation level in AH at 6 and 24 h following FTO-antisense injection. Global m6A RNA methylation was augmented by 40% at 24 h after the FTO-antisense injection (p = 0.023; Fig. 3C). At the next step, expression levels of EZH2, BDNF, and HSP70 were quantified. FTO-antisense knock-down resulted in reduction of both EZH2 and BDNF by 25 and 15%, respectively, at 24 h after the treatment (p = 0.005 for EZH2 and p = 0.053 for BDNF), but one week after mRNA, levels of both transcripts corresponded to those in sense‐treated chicks (Fig. 3D,E). It should be noted that no changes were detected in HSP70 mRNA levels following FTO-antisense injection (Fig. 3F).

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

FTO‐antisense knock-down affects EZH2 and BDNF mRNA expression in the AH. A, Schematic representation of the treatment protocol. FTO-antisense was injected into the third ventricle on day 3 posthatch. Chicks injected with FTO-sense were used as controls. One week after (day 10), the chicks heat challenged by exposure to 36°C for 6 h. Chicks were killed 2 h, 6 h, 24 h, and 7 d following FTO-sense/antisense injection, and their AH was dissected for following analyses. B, Pharmacokinetic evaluation of FTO‐antisense knock-down in the AH by measuring FTO mRNA expression. Total RNA was isolated from the AH and subjected to real-time PCR with FTO-specific primers. HMBS was used as a standard gene. The relative PCR values of antisense-treated chicks were normalized to respective sense ones, set as 1. Each bar represents mean ± SEM (n = 8 at 2 h; n = 20 at 6 h; and n = 22 at 24 h); * indicates significant difference between sense and antisense counterparts 6 h following antisense treatment (t(41) = 2.50, p = 0.016; Student’s t test). C, Quantification of global m6A RNA methylation in the AH following FTO-antisense treatment. Results are absolute amount (%) of m6A in total RNA at each indicated time. Each bar represents average m6A RNA methylation percentage (n = 10 at 6 h and n = 21 at 24 h); * indicates significant difference between sense and antisense counterparts 24 h following antisense treatment (t(40) = 2.37, p = 0.023 Student’s t test). D–F, Effect of FTO‐antisense knock-down on EZH2 (D), BDNF (E), and HSP70 (F) mRNA expression. Total RNA was isolated from the AH and subjected to real-time PCR with EZH2-, BDNF-, and HSP70-specific primers. HMBS was used as a standard gene. The relative PCR values of antisense injected chicks were normalized to those of respective sense, set as 1. Each bar represents mean ± SEM (n = 22 at 6 and 24 h; and n = 33 at 7 d); *p = 0.053 (t(42) = 1.99, Student’s t test) and *p = 0.005 (t(42) = 2.95, Student’s t test) compared with respective control.

Effect of FTO-antisense knock-down on histone 3 lysine 27 (H3K27) methylation in the AH

To further evaluate the downstream effects of the FTO‐antisense inhibition mediated by EZH2 function, EZH2 protein expression was analyzed in the AH of FTO‐antisense‐injected chicks and compared with its expression level in FTO‐sense‐injected ones. The effect of intracranial injection of the FTO‐antisense on EZH2 protein levels was similar to that on EZH2 mRNA expression, with ∼25% inhibition of EZH2 observed at 24 h after FTO‐antisense treatment (p = 0.059), but no changes in EZH2 levels one week after (Fig. 4A). Since, EZH2 is an H3K27-specific methyltransferase, (Laugesen et al., 2019), we analyzed global methylation of H3K27 after FTO‐antisense injection. FTO‐antisense knock-down resulted in long-term decrease in H3K27 dimethylation (H3K27me2; Fig. 4B), but did not affect H3K27 trimethyl levels (H3K27me3; Fig. 4C). A significant decrease in H3K27me2 was detected 24 h after FTO‐antisense injection (∼50%; p = 0.037), and one week after the treatment, H3K27me2 levels in antisense-injected chicks remained lower by ∼30% than in sense-treated counterparts (p = 0.089; Fig. 4B). Given that H3K27me2 is involved in transcriptional regulation of BDNF expression (Kisliouk and Meiri, 2009), a ChIP assay was performed in FTO‐knock-down chicks 24 h after the antisense treatment. H3K27me2 level at the 5′‐proximal regions, −869 to −801 bp upstream and +91 to +190 bp into the BDNF coding region, was ∼ 50% lower in FTO‐antisense‐injected chicks comparing with sense-injected counterparts (p = 0.019 for upstream part and p = 0.040 for coding region; Fig. 4D). No significant decrease in H3K27me2 levels was measured at the BDNF 3′-UTR (+1623 to +1698 bp downstream of the translation start site), using as a control (Fig. 4D). These data can imply a long-term effect of FTO-antisense inhibition resulted in reduction of EZH2 level and decrease in H3K27 dimethylation.

Figure 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4.

FTO‐antisense knock-down affects methylation of the EZH2 substrate, histone H3 at lysine 27 (H3K27), in the AH. A, Time course of EZH2 protein inhibition following FTO-antisense injection by Western blot analysis. Total protein was isolated from the AH samples at 24 h and 7 d following FTO-antisense or sense injection and subjected to immunoblotting with anti‐EZH2 antibody. Upper panels, Representative blots. Lower panels, Densitometric quantification of EZH2 levels relative to ACTB expression. The ratio between EZH2 and ACTB levels in sense‐injected chicks at each indicated time was set to 1. Each bar represents the mean ± SEM of 9–11 individual chicks; *p = 0.059 compared with respective sense (t(18) = 2.01, Student’s t test). B, C, Evaluation of global levels of dimethyl and trimethyl histone H3 lysine27 (H3K27me2 and H3K27me3, respectively) after FTO-antisense injection. The protein samples described in A were immunoblotted with anti‐H3K27me2 (B) and anti‐H3K27me3 (C) antibodies. Upper panels, Representative blots. Lower panels, Densitometric quantification of H3K27me2 (B) and H3K27me3 (C) levels relative to ACTB expression in the same samples. Each bar represents the mean ± SEM of 9–10 individual chicks; *p = 0.089 (t(16) = 1.81, Student’s t test) and * *p = 0.037 (t(17) = 2.27, Student’s t test) compared with respective sense. D, Effect of FTO‐antisense inhibition on dimethylation of H3K27 (H3K27me2) along BDNF coding region. AH samples were collected 24 h after FTO-antisense or sense treatment, immunoprecipitated with anti‐H3K27me2 antibody (H3K27me2-IP), and subjected to real‐time PCR with BDNF‐specific primers aligning at position −869 to –801 bp upstream of the coding region, +91 to +190 bp into the coding region and +1623 to +1698 bp downstream of the translation start site. Immunoprecipitation with normal mouse IgG was used as a background (IgG-IP). Results are mean ± SEM of 9–10 chicks in each group; * *p = 0.019 (t(18) = 2.65, Student’s t test) for the area upstream of the BDNF coding region and p = 0.040 for the coding region (t(18) = 2.27, Student’s t test) compared with sense.

FTO-antisense knock-down affects the thermal control establishment and leads to heat vulnerability later in life

After evaluating the biochemical effect of the FTO-antisense inhibition on EZH2 and BDNF expression, we examined the phenotypic effect of FTO-antisense injection by measuring the injected chicks’ body temperature. Intracranial injection of FTO-antisense resulted in elevation of the chicks’ basal body temperatures. Six hours after the treatment, the body temperature of FTO‐antisense‐injected chicks was 0.3°C higher than that in FTO‐sense‐treated counterparts (41.0 ± 0.05°C in antisense-treated chicks vs 40.7 ± 0.07°C in sense-treated chicks; p = 0.001), and at 24 h, it remained at the same level (41.0 ± 0.07°C in antisense-treated chicks vs 40.7 ± 0.05°C in sense-treated chicks; p = 0.003; Fig. 5A). Although no significant differences were observed in the body temperatures of the examined chick groups one week following FTO‐antisense injection (40.9 ± 0.05°C in antisense-treated chicks vs 41.0 ± 0.04°C in sense-treated chicks), at 6 h of heat challenge on day 10 posthatch, the body temperature of FTO‐antisense‐injected chicks was 0.5°C higher than that in FTO‐sense‐treated counterparts (42.8 ± 0.11°C in antisense-treated chicks vs 42.3 ± 0.11°C in sense-treated chicks; p = 0.004; Fig. 5B). Hence, FTO‐antisense‐injected chicks demonstrated vulnerable response to heat stress. To further prove the role of FTO-antisense knock-down in heat vulnerability, the mRNA level of the heat stress marker, HSP70 (Kisliouk et al., 2017), was measured in the AH of FTO-antisense-treated chicks during the heat challenge. The highest level of the HSP70 mRNA was observed in FTO‐antisense‐injected chicks at 6 h into the challenge, at which time, it was almost 1.4 times higher than that in FTO‐sense‐treated counterparts (p = 0.023; Fig. 5C). Thus, FTO-antisense knock-down on day 3 posthatch revealed vulnerability to heat challenge on day 10 posthatch.

Figure 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5.

Effect of FTO-antisense knock-down on chick thermal response during heat challenge. A, Alterations in body temperature of 3‐d‐old chicks after FTO-antisense injection. Chick body temperature was measured 6 and 24 h after FTO-antisense or sense treatment. The graph represents the mean ± SEM of 26 and 38 chicks at 6 and 24 h, respectively; * indicates significant difference in the body temperature between sense and antisense at the same time point (t(50) = −3.43, p = 0.001 Student’s t test at 6 h and t(73) = −3.05, p = 0.003 Student’s t test at 24 h). B, Changes in body temperature of 10‐d‐old chicks previously injected with FTO-antisense during heat challenge. Following FTO-antisense or sense injection on day 3, the chicks kept at 30°C until day 10. Body temperature was measured before and 6 h into heat challenge. Results are mean ± SEM of 32–34 chicks at each time point; * indicates significant difference in the body temperature between treatments at the same time point (t(63) = 3.03, p = 0.004; Student’s t test). C, HSP70 mRNA expression in the AH during heat challenge of FTO-antisense-treated chicks. The chicks were treated as described in B. Total RNA was isolated before and 6 h into the challenge and subjected to real-time PCR with HSP70-specific primers. HMBS was used as a standard gene. The relative PCR values of antisense-treated chicks were normalized to respective sense ones, set as 1. Each bar represents mean ± SEM of 31–32 chicks at each time point; * indicates significant differences in HSP70 mRNA expression between treatments at the same time point (t(60) = 2.34, p = 0.023 Student’s t test).

Discussion

Fine-tuning of the thermal-response set point during the critical postnatal sensory-developmental period can determine future reactions to heat stress, inducing either resilience or vulnerability. Epigenetic modifications are involved in early life environmental programming, establishing a specific chromatin state to specify gene expression patterns associated with cellular memory (Franklin et al., 2012; Braun et al., 2017; Lux, 2018). We have previously shown that specific epigenetic marking of CRH intron (Cramer et al., 2019) and HSP70 promoter (Kisliouk et al., 2017) in response to harsh or mild heat stress at the critical development period underlay their differential expression during heat challenge later in life. Here, we demonstrate a role for epitranscriptomic regulation affecting the thermal control establishment. Chemical modifications on RNA have been shown to influence mRNA metabolism and thus fine-tune gene expression on top of the epigenetic code (Meyer et al., 2012; Gilbert et al., 2016; Nainar et al., 2016; Shi et al., 2019). Given that m6A is the most abundant epitranscriptomic mark existing across different brain regions (Chang et al., 2017), and it was identified in different aspects of the brain functions, among them learning and memory (Widagdo et al., 2016; Walters et al., 2017; Li et al., 2018; Shi et al., 2018) and acute stress response (Engel et al., 2018), it was of interest to explore the role of m6A RNA methylation in thermal control establishment and long-term heat stress response.

Here, we demonstrate that acute heat stress diminished global m6A RNA levels in the AH. Moreover, heat exposure at the critical period of thermal‐control establishment has a long‐term effect on RNA methylation: one week after the treatment, m6A global levels in both harsh- and mild-temperature-conditioned chicks were significantly lower than those in non-conditioned counterparts. Although two other studies have shown an increase in m6A RNA methylation in sheep liver (Shi et al., 2018) and abdominal fat and liver of piglets (Heng et al., 2019) under exposure to high environmental temperature, the differential effect of heat stress on m6A modification may be reasoned by different experimental models (animals, organs, and tissues) as well as heat stress stringency. Regulation of m6A RNA levels in the brain has been shown to be highly specific in a context‐ and experience‐dependent manner (Widagdo et al., 2016; Chang et al., 2017; Walters et al., 2017; Widagdo and Anggono, 2018). Time course of RNA methylation in response to acute restraint stress in mouse brain revealed a decrease in m6A levels in the medial prefrontal cortex simultaneously with their increase in the amygdala (Engel et al., 2018). In addition, global RNA methylation was transiently decreased in whole blood of mice after acute stress (Engel et al., 2018). Apparently, stress-regulation of m6A modification is time and region dependent.

Whereas global RNA methylation describes an average of m6A modifications along the transcriptome, and therefore gives little information about the regulation of the repertoire of proteins that are relevant to the physiological state of the cells, we measured m6A levels at specific transcripts, EZH2, BDNF, and HSP70, the essential role of which was previously explored in heat stress response (Yossifoff et al., 2008; Kisliouk and Meiri, 2009; Kisliouk et al., 2011, 2017). Here, we showed that exposure to harsh heat stress during the critical period of thermal control establishment (day 3 posthatch) resulted in significant decrease in methylation of the EZH2 and BDNF transcripts in the AH one week after the treatment. Methylation level of the same transcripts in mild‐heat‐conditioned chicks was unaffected. However, heat challenge on day 10 posthatch resulted in reduction of m6A levels at both transcripts in mild-heat-conditioned chicks and its elevation in high-temperature-conditioned ones. It should be noted that these alterations in m6A levels at the EZH2 and BDNF transcripts were AH specific and were not detected in other brain regions, such as FB or IMM, indicating the distinct role of the AH in heat stress processing and reprogramming the response to further challenges. In addition, changes in m6A modification may provide a long‐term effect on the regulation of both EZH2 and BDNF expression under different stress conditions, for example, harsh heat stress versus mild heat stress. Moreover, an increase of this modification at the EZH2 and BDNF transcripts was accompanied by decrease in their mRNA levels, arguing for elevated m6A levels correlating with mRNA decay (Widagdo et al., 2016; Engel et al., 2018). While a several in vitro studies previously demonstrated that HSP70 expression is modulated by m6A level (Zhou et al., 2015; Yu et al., 2018b), no changes were found in m6A levels at the HSP70 transcript in response to aforementioned heat treatments. Perhaps, m6A is not involved in long-term regulation of the HSP70 RNA expression in chick hypothalamus in response to heat stress. In contrast, epigenetic marking at the HSP70 promoter in the AH, as we have previously shown, differentiate between its heat resilience and vulnerability (Kisliouk et al., 2017). Furthermore, differential m6A regulation of EZH2 and BDNF, on the one hand, and HSP70, on the other hand, point to a target-specific role of the m6A in the environmental programming of gene expression.

To more specifically explore the role of m6A RNA methylation in heat stress regulation, FTO-antisense DNA was intracranially injected into the third ventricle during the critical period for the establishment of thermal control. FTO-antisense knock-down in the AH resulted in transient decrease in both EZH2 and BDNF mRNA expression, further supporting the observation that an increase in m6A levels can lead to mRNA degradation. Our findings are consistent with recent studies demonstrating reduction of BDNF expression as well as several key components of BDNF signaling pathway in the hippocampus of Fto-knock-out mice, which was also attended by impaired adult neurogenesis and learning and memory (Li et al., 2017; Spychala and Rüther, 2019). On the other hand, Mettl3 knock-down, resulted in a decrease in m6A levels, has been shown to reduce both Ezh2 protein expression and consequent H3K27me3 levels and altered the proliferation and cell cycle progression of adult neural stem cells (Chen et al., 2019a). Probably, m6A levels below or above a certain threshold impair the regulation of mRNA expression and/or degradation.

Since the functional consequence of m6A methylation of the EZH2 transcript can be evaluated by H3K27 methylation, we analyzed the levels of H3K27me2 and H3K27me3 in the Ant Hyp following FTO-antisense knock-down. Interestingly, transient FTO-antisense inhibition had long-term inhibitory effect on H3K27me2 but did not affect H3K27me3 levels. Long-term decline of H3K27me2, comparing with EZH2 transient inhibition by FTO-antisense knock-down, can be explained by the presence of other regulatory mechanisms balancing between methylation and demethylation processes (Lee et al., 2007). Moreover, increase in m6A RNA methylation, following FTO-antisense inhibition, may also influence the expression level of histone demethylases. These results also support our previous findings, demonstrating a significant increase in H3K27me2 simultaneously with EZH2 expression but no changes in H3K27me3, in chick hypothalamus during heat conditioning (Kisliouk and Meiri, 2009). Furthermore, EZH2 transient inhibition by Mir-138 in chick hypothalamus caused more profound inhibitory effect on H3K27me2 than on H3K23me3 (Kisliouk et al., 2011). Apparently, H3K27me2 is highly susceptible histone modification involved in transcriptional regulation of stress-activated genes in hypothalamic neuronal circuits. Indeed, a decrease in H3K27me2 level at the BDNF gene coding area following FTO-antisense injection suggests a role for H3K27me2 mark in this context. Moreover, our previous study has emphasized a specific role of the H3K27me2 modification at the BDNF promoter and coding region in the establishment of thermal control set point (Kisliouk and Meiri, 2009).

Phenotypically, FTO-antisense knock-down on day 3 posthatch led to heat stress vulnerability later in life, manifested by higher increase in the body temperature and HSP70 mRNA levels at heat challenge on day 10 posthatch. Similarly, Fto-knock-out in mice was resulted in a hyperactivation of the hypothalamic-pituitary-adrenal axis (Spychala and Rüther, 2019). Vulnerability to heat stress in FTO-antisense knock-down chicks, on the one hand, and increase in fear memory (Widagdo et al., 2016; Walters et al., 2017; Engel et al., 2018) and anxiety-like behavior (Spychala and Rüther, 2019) in Fto-knock-down mice, on the other hands, highlight the role of m6A RNA methylation in different memory-related processes.

To summarize, FTO-antisense knock-down in chick hypothalamus partially “mimics” the effects of heat challenge of 40°C-conditioned chicks, exhibited in elevation of global m6A RNA methylation, reduction of EZH2 and BDNF mRNA levels, and decrease in global H3K27 dimethylation as well as dimethyl H3K27 level along the BDNF coding region, and, finally, lead to vulnerable response to heat stress. Here, we present a dual-level regulation of BDNF expression in response to heat stress, including m6A marks on BDNF transcript and H3K27me2 modifications on BDNF gene. We suppose that cross talk between epigenetic and epitranscriptomic regulation can balance the response of stress-related neuronal networks to the future challenges.

Acknowledgments

Acknowledgements: We thank the Volcani Institute chicken farm staff for their dedicated work.

Footnotes

  • The authors declare no competing financial interests.

  • This work was supported by the Israel Science Foundation Grant 1646/15.

This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license, which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed.

References

  1. ↵
    Boulant JA (2006) Neuronal basis of Hammel’s model for set-point thermoregulation. J Appl Physiol 100:1347–1354. doi:10.1152/japplphysiol.01064.2005 pmid:16540713
    OpenUrlCrossRefPubMed
  2. ↵
    Braun K, Bock J, Wainstock T, Matas E, Gaisler-Salomon I, Fegert J, Ziegenhain U, Segal M (2017) Experience-induced transgenerational (re-)programming of neuronal structure and functions: impact of stress prior and during pregnancy. Neurosci Biobehav Rev S0149-7634(16)30731-X.
  3. ↵
    Cao G, Li HB, Yin Z, Flavell RA (2016) Recent advances in dynamic m6A RNA modification. Open Biol 6:160003. doi:10.1098/rsob.160003 pmid:27249342
    OpenUrlCrossRefPubMed
  4. ↵
    Chang M, Lv H, Zhang W, Ma C, He X, Zhao S, Zhang ZW, Zeng YX, Song S, Niu Y, Tong WM (2017) Region-specific RNA m(6)A methylation represents a new layer of control in the gene regulatory network in the mouse brain. Open Biol 7:170166. doi:10.1098/rsob.170166
    OpenUrlCrossRefPubMed
  5. ↵
    Chen J, Zhang YC, Huang C, Shen H, Sun B, Cheng X, Zhang YJ, Yang YG, Shu Q, Yang Y, Li X (2019a) m6A regulates neurogenesis and neuronal development by modulating histone methyltransferase Ezh2. Genomics Proteomics Bioinformatics 17:154–168. doi:10.1016/j.gpb.2018.12.007 pmid:31154015
    OpenUrlCrossRefPubMed
  6. ↵
    Chen X, Yu C, Guo M, Zheng X, Ali S, Huang H, Zhang L, Wang S, Huang Y, Qie S, Wang J (2019b) Down-regulation of m6A mRNA methylation is involved in dopaminergic neuronal death. ACS Chem Neurosci 10:2355–2363. doi:10.1021/acschemneuro.8b00657 pmid:30835997
    OpenUrlCrossRefPubMed
  7. ↵
    Cramer T, Kisliouk T, Yeshurun S, Meiri N (2015) The balance between stress resilience and vulnerability is regulated by corticotropin-releasing hormone during the critical postnatal period for sensory development. Dev Neurobiol 75:842–853. doi:10.1002/dneu.22252 pmid:25447645
    OpenUrlCrossRefPubMed
  8. ↵
    Cramer T, Rosenberg T, Kisliouk T, Meiri N (2019) Early-life epigenetic changes along the corticotropin-releasing hormone (CRH) gene influence resilience or vulnerability to heat stress later in life. Mol Psychiatry 24:1013–1026. doi:10.1038/s41380-018-0280-5 pmid:30742007
    OpenUrlCrossRefPubMed
  9. ↵
    Dominissini D, Moshitch-Moshkovitz S, Salmon-Divon M, Amariglio N, Rechavi G (2013) Transcriptome-wide mapping of N6-methyladenosine by m6A-seq based on immunocapturing and massively parallel sequencing. Nat Protoc 8:176–189. doi:10.1038/nprot.2012.148 pmid:23288318
    OpenUrlCrossRefPubMed
  10. ↵
    Du K, Zhang L, Lee T, Sun T (2019) m6A RNA methylation controls neural development and is involved in human diseases. Mol Neurobiol 56:1596–1606. doi:10.1007/s12035-018-1138-1 pmid:29909453
    OpenUrlCrossRefPubMed
  11. ↵
    Engel M, Eggert C, Kaplick PM, Eder M, Röh S, Tietze L, Namendorf C, Arloth J, Weber P, Rex-Haffner M, Geula S, Jakovcevski M, Hanna JH, Leshkowitz D, Uhr M, Wotjak CT, Schmidt MV, Deussing JM, Binder EB, Chen A (2018) The role of m(6)A/m-RNA methylation in stress response regulation. Neuron 99:389–403.e9. doi:10.1016/j.neuron.2018.07.009 pmid:30048615
    OpenUrlCrossRefPubMed
  12. ↵
    Franklin TB, Saab BJ, Mansuy IM (2012) Neural mechanisms of stress resilience and vulnerability. Neuron 75:747–761. doi:10.1016/j.neuron.2012.08.016 pmid:22958817
    OpenUrlCrossRefPubMed
  13. ↵
    Gilbert WV, Bell TA, Schaening C (2016) Messenger RNA modifications: form, distribution, and function. Science 352:1408–1412. doi:10.1126/science.aad8711 pmid:27313037
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Heng J, Tian M, Zhang W, Chen F, Guan W, Zhang S (2019) Maternal heat stress regulates the early fat deposition partly through modification of m6A RNA methylation in neonatal piglets. Cell Stress Chaperones 24:635–645. doi:10.1007/s12192-019-01002-1
    OpenUrlCrossRef
  15. ↵
    Hess ME, Hess S, Meyer KD, Verhagen LA, Koch L, Brönneke HS, Dietrich MO, Jordan SD, Saletore Y, Elemento O, Belgardt BF, Franz T, Horvath TL, Rüther U, Jaffrey SR, Kloppenburg P, Brüning JC (2013) The fat mass and obesity associated gene (Fto) regulates activity of the dopaminergic midbrain circuitry. Nat Neurosci 16:1042–1048. doi:10.1038/nn.3449 pmid:23817550
    OpenUrlCrossRefPubMed
  16. ↵
    Kisliouk T, Meiri N (2009) A critical role for dynamic changes in histone H3 methylation at the Bdnf promoter during postnatal thermotolerance acquisition. Eur J Neurosci 30:1909–1922. doi:10.1111/j.1460-9568.2009.06957.x pmid:19840109
    OpenUrlCrossRefPubMed
  17. ↵
    Kisliouk T, Ziv M, Meiri N (2010) Epigenetic control of translation regulation: alterations in histone H3 lysine 9 post-translation modifications are correlated with the expression of the translation initiation factor 2B (Eif2b5) during thermal control establishment. Dev Neurobiol 70:100–113. doi:10.1002/dneu.20763 pmid:19950192
    OpenUrlCrossRefPubMed
  18. ↵
    Kisliouk T, Yosefi S, Meiri N (2011) MiR-138 inhibits EZH2 methyltransferase expression and methylation of histone H3 at lysine 27, and affects thermotolerance acquisition. Eur J Neurosci 33:224–235. doi:10.1111/j.1460-9568.2010.07493.x pmid:21070394
    OpenUrlCrossRefPubMed
  19. ↵
    Kisliouk T, Cramer T, Meiri N (2014) Heat stress attenuates new cell generation in the hypothalamus: a role for miR-138. Neuroscience 277:624–636. doi:10.1016/j.neuroscience.2014.07.047 pmid:25086319
    OpenUrlCrossRefPubMed
  20. ↵
    Kisliouk T, Cramer T, Meiri N (2017) Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex. J Neurochem 141:358–372. doi:10.1111/jnc.14014 pmid:28278364
    OpenUrlCrossRefPubMed
  21. ↵
    Kuenzel WJ (1988) A stereotaxic atlas of the brain of the chick (Gallus domesticus). Baltimore: Johns Hopkins University Press.
  22. ↵
    Laugesen A, Højfeldt JW, Helin K (2019) Molecular mechanisms directing PRC2 recruitment and H3K27 methylation. Mol Cell 74:8–18. doi:10.1016/j.molcel.2019.03.011 pmid:30951652
    OpenUrlCrossRefPubMed
  23. ↵
    Lee MG, Villa R, Trojer P, Norman J, Yan K-P, Reinberg D, Di Croce L, Shiekhattar R (2007) Demethylation of H3K27 regulates polycomb recruitment and H2A ubiquitination. Science 318:447–450. doi:10.1126/science.1149042 pmid:17761849
    OpenUrlAbstract/FREE Full Text
  24. ↵
    Li H, Ren Y, Mao K, Hua F, Yang Y, Wei N, Yue C, Li D, Zhang H (2018) FTO is involved in Alzheimer’s disease by targeting TSC1-mTOR-Tau signaling. Biochem Biophys Res Commun 498:234–239. doi:10.1016/j.bbrc.2018.02.201 pmid:29501742
    OpenUrlCrossRefPubMed
  25. ↵
    Li L, Zang L, Zhang F, Chen J, Shen H, Shu L, Liang F, Feng C, Chen D, Tao H, Xu T, Li Z, Kang Y, Wu H, Tang L, Zhang P, Jin P, Shu Q, Li X (2017) Fat mass and obesity-associated (FTO) protein regulates adult neurogenesis. Hum Mol Genet 26:2398–2411. doi:10.1093/hmg/ddx128 pmid:28398475
    OpenUrlCrossRefPubMed
  26. ↵
    Lux V (2018) Epigenetic programming effects of early life stress: a dual-activation hypothesis. Curr Genomics 19:638–652. doi:10.2174/1389202919666180307151358 pmid:30532644
    OpenUrlCrossRefPubMed
  27. ↵
    Merkurjev D, Hong WT, Iida K, Oomoto I, Goldie BJ, Yamaguti H, Ohara T, Kawaguchi S, Hirano T, Martin KC, Pellegrini M, Wang DO (2018) Synaptic N6-methyladenosine (m6A) epitranscriptome reveals functional partitioning of localized transcripts. Nat Neurosci 21:1004–1014. doi:10.1038/s41593-018-0173-6 pmid:29950670
    OpenUrlCrossRefPubMed
  28. ↵
    Meyer KD, Saletore Y, Zumbo P, Elemento O, Mason CE, Jaffrey SR (2012) Comprehensive analysis of mRNA methylation reveals enrichment in 3′ UTRs and near stop codons. Cell 149:1635–1646. doi:10.1016/j.cell.2012.05.003 pmid:22608085
    OpenUrlCrossRefPubMed
  29. ↵
    Nainar S, Marshall PR, Tyler CR, Spitale RC, Bredy TW (2016) Evolving insights into RNA modifications and their functional diversity in the brain. Nat Neurosci 19:1292–1298. doi:10.1038/nn.4378 pmid:27669990
    OpenUrlCrossRefPubMed
  30. ↵
    Roignant JY, Soller M (2017) m6A in mRNA: an ancient mechanism for fine-tuning gene expression. Trends Genet 33:380–390. doi:10.1016/j.tig.2017.04.003 pmid:28499622
    OpenUrlCrossRefPubMed
  31. ↵
    Ruud J, Alber J, Tokarska A, Engström Ruud L, Nolte H, Biglari N, Lippert R, Lautenschlager Ä, Cieślak PE, Szumiec Ł, Hess ME, Brönneke HS, Krüger M, Nissbrandt H, Korotkova T, Silberberg G, Rodriguez Parkitna J, Brüning JC (2019) The fat mass and obesity-associated protein (FTO) regulates locomotor responses to novelty via D2R medium spiny neurons. Cell Rep 27:3182–3198.e9. doi:10.1016/j.celrep.2019.05.037 pmid:31189104
    OpenUrlCrossRefPubMed
  32. ↵
    Shi H, Zhang X, Weng YL, Lu Z, Liu Y, Lu Z, Li J, Hao P, Zhang Y, Zhang F, Wu Y, Delgado JY, Su Y, Patel MJ, Cao X, Shen B, Huang X, Ming GL, Zhuang X, Song H, et al. (2018) m6A facilitates hippocampus-dependent learning and memory through YTHDF1. Nature 563:249–253. doi:10.1038/s41586-018-0666-1 pmid:30401835
    OpenUrlCrossRefPubMed
  33. ↵
    Shi H, Wei J, He C (2019) Where, when, and how: context-dependent functions of RNA methylation writers, readers, and erasers. Mol Cell 74:640–650. doi:10.1016/j.molcel.2019.04.025 pmid:31100245
    OpenUrlCrossRefPubMed
  34. ↵
    Spychala A, Rüther U (2019) FTO affects hippocampal function by regulation of BDNF processing. PLoS One 14:e0211937. doi:10.1371/journal.pone.0211937 pmid:30730976
    OpenUrlCrossRefPubMed
  35. ↵
    Tzschentke B, Basta D (2002) Early development of neuronal hypothalamic thermosensitivity in birds: influence of epigenetic temperature adaptation. Comp Biochem Physiol Part A Mol Integr Physiol 131:825–832. doi:10.1016/S1095-6433(02)00020-X
    OpenUrlCrossRefPubMed
  36. ↵
    van Bodegom M, Homberg JR, Henckens M (2017) Modulation of the hypothalamic-pituitary-adrenal axis by early life stress exposure. Front Cell Neurosci 11:87. doi:10.3389/fncel.2017.00087 pmid:28469557
    OpenUrlCrossRefPubMed
  37. ↵
    Walters BJ, Mercaldo V, Gillon CJ, Yip M, Neve RL, Boyce FM, Frankland PW, Josselyn SA (2017) The role of the RNA demethylase FTO (fat mass and obesity-associated) and mRNA methylation in hippocampal memory formation. Neuropsychopharmacology 42:1502–1510. doi:10.1038/npp.2017.31 pmid:28205605
    OpenUrlCrossRefPubMed
  38. ↵
    Wang TA, Teo CF, Åkerblom M, Chen C, Tynan-La Fontaine M, Greiner VJ, Diaz A, McManus MT, Jan YN, Jan LY (2019) Thermoregulation via temperature-dependent PGD2 production in mouse preoptic area. Neuron 103:309–322.e7. doi:10.1016/j.neuron.2019.04.035 pmid:31151773
    OpenUrlCrossRefPubMed
  39. ↵
    Weng YL, Wang X, An R, Cassin J, Vissers C, Liu Y, Liu Y, Xu T, Wang X, Wong SZ, Joseph J, Dore LC, Dong Q, Zheng W, Jin P, Wu H, Shen B, Zhuang X, He C, Liu K, et al. (2018) Epitranscriptomic m6A regulation of axon regeneration in the adult mammalian nervous system. Neuron 97:313–325.e6. doi:10.1016/j.neuron.2017.12.036 pmid:29346752
    OpenUrlCrossRefPubMed
  40. ↵
    Widagdo J, Anggono V (2018) The m6A-epitranscriptomic signature in neurobiology: from neurodevelopment to brain plasticity. J Neurochem 147:137–152. doi:10.1111/jnc.14481 pmid:29873074
    OpenUrlCrossRefPubMed
  41. ↵
    Widagdo J, Zhao Q-Y, Kempen M-J, Tan MC, Ratnu VS, Wei W, Leighton L, Spadaro PA, Edson J, Anggono V, Bredy TW (2016) Experience-dependent accumulation of N6-methyladenosine in the prefrontal cortex is associated with memory processes in mice. J Neurosci 36:6771–6777. doi:10.1523/JNEUROSCI.4053-15.2016 pmid:27335407
    OpenUrlAbstract/FREE Full Text
  42. ↵
    Yahav S, Hurwitz S (1996) Induction of thermotolerance in male broiler chickens by temperature conditioning at an early age. Poult Sci 75:402–406. doi:10.3382/ps.0750402 pmid:8778736
    OpenUrlCrossRefPubMed
  43. ↵
    Yoon KJ, Ringeling FR, Vissers C, Jacob F, Pokrass M, Jimenez-Cyrus D, Su Y, Kim NS, Zhu Y, Zheng L, Kim S, Wang X, Doré LC, Jin P, Regot S, Zhuang X, Canzar S, He C, Ming GL, Song H (2017) Temporal control of mammalian cortical neurogenesis by m(6)A methylation. Cell 171:877–889.e17. doi:10.1016/j.cell.2017.09.003 pmid:28965759
    OpenUrlCrossRefPubMed
  44. ↵
    Yossifoff M, Kisliouk T, Meiri N (2008) Dynamic changes in DNA methylation during thermal control establishment affect CREB binding to the brain-derived neurotrophic factor promoter. Eur J Neurosci 28:2267–2277. doi:10.1111/j.1460-9568.2008.06532.x pmid:19046370
    OpenUrlCrossRefPubMed
  45. ↵
    Yu J, Chen M, Huang H, Zhu J, Song H, Zhu J, Park J, Ji SJ (2018a) Dynamic m6A modification regulates local translation of mRNA in axons. Nucleic Acids Res 46:1412–1423. doi:10.1093/nar/gkx1182 pmid:29186567
    OpenUrlCrossRefPubMed
  46. ↵
    Yu J, Li Y, Wang T, Zhong X (2018b) Modification of N6-methyladenosine RNA methylation on heat shock protein expression. PLoS One 13:e0198604. doi:10.1371/journal.pone.0198604 pmid:29902206
    OpenUrlCrossRefPubMed
  47. ↵
    Zhang Z, Wang M, Xie D, Huang Z, Zhang L, Yang Y, Ma D, Li W, Zhou Q, Yang Y-G, Wang X-J (2018) METTL3-mediated N(6)-methyladenosine mRNA modification enhances long-term memory consolidation. Cell Res 28:1050–1061. doi:10.1038/s41422-018-0092-9 pmid:30297870
    OpenUrlCrossRefPubMed
  48. ↵
    Zhou J, Wan J, Gao X, Zhang X, Jaffrey SR, Qian SB (2015) Dynamic m6A mRNA methylation directs translational control of heat shock response. Nature 526:591–594. doi:10.1038/nature15377 pmid:26458103
    OpenUrlCrossRefPubMed

Synthesis

Reviewing Editor: Margaret McCarthy, Univ of Maryland School of Medicine

Decisions are customarily a result of the Reviewing Editor and the peer reviewers coming together and discussing their recommendations until a consensus is reached. When revisions are invited, a fact-based synthesis statement explaining their decision and outlining what is needed to prepare a revision will be listed below. The following reviewer(s) agreed to reveal their identity: Anthony Auger.

This work builds on previous papers and provides interesting, but somewhat limited new insights into molecular mechanisms of heat stress conditioning.

1)Specific changes requested

“Ant Hyp” could simply be “AH”.

Statistics: Please add if and how you tested for normal distributions and equal variances.

Line 12: “two” in text, but three listed

Line 97: “European Community Council” - Please clarify which guidelines or protocols were followed.

Line 107: Please explain the dissection approach in greater detail. Were the brains first sectioned, and then the AH removed in the sections that contained it? How did you identify the AH boundaries?

Line 331: Please show the antisense-injected hsp70 mRNA data.

Line 364: How relevant is a body temperature increase of 0.3-0.5 C?

Fig. 1A, 3A: These diagrams could be made clearer, for example by switching the use of arrows and bars: arrows for specific sacrifice time points and bars for longer heat stimulation times.

Fig. 6 summarizes the findings and can be used as a visual abstract

2) General comments for consideration or implementation

More experiments showing that the effects are specific to the relevant brain region would help complete the picture.

Since only the Ant Hyp was analyzed, adding another brain region as a control would show how specific the effects are. ISH/IHC stainings showing changes in mRNA or protein levels could support regional specificity as well. Are the effects a result of hypothalamic stress processing (HPA axis), or cellular stress responses? This could be explained more in the discussion.

This is an interesting article regarding 6mA and RNA regulation. My only comment is whether 6mA could contribute to differential splicing of RNA rather than just degradation of the transcript. While other studies support the idea that RNA is degraded in some manner, i was just curious about this possibility, especially in regard to BDNF when there are many splice variants.

Back to top

In this issue

eneuro: 7 (3)
eNeuro
Vol. 7, Issue 3
Month/Month
  • Table of Contents
  • Index by author
  • Ed Board (PDF)
Email

Thank you for sharing this eNeuro article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Early-Life m6A RNA Demethylation by Fat Mass and Obesity-Associated Protein (FTO) Influences Resilience or Vulnerability to Heat Stress Later in Life
(Your Name) has forwarded a page to you from eNeuro
(Your Name) thought you would be interested in this article in eNeuro.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
Early-Life m6A RNA Demethylation by Fat Mass and Obesity-Associated Protein (FTO) Influences Resilience or Vulnerability to Heat Stress Later in Life
Tatiana Kisliouk, Tali Rosenberg, Osher Ben-Nun, Mark Ruzal, Noam Meiri
eNeuro 17 June 2020, 7 (3) ENEURO.0549-19.2020; DOI: 10.1523/ENEURO.0549-19.2020

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Share
Early-Life m6A RNA Demethylation by Fat Mass and Obesity-Associated Protein (FTO) Influences Resilience or Vulnerability to Heat Stress Later in Life
Tatiana Kisliouk, Tali Rosenberg, Osher Ben-Nun, Mark Ruzal, Noam Meiri
eNeuro 17 June 2020, 7 (3) ENEURO.0549-19.2020; DOI: 10.1523/ENEURO.0549-19.2020
del.icio.us logo Digg logo Reddit logo Twitter logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Visual Abstract
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
    • Synthesis
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • chick
  • epigenetics
  • epitranscriptomics
  • FTO
  • hypothalamus
  • Thermoregulation

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

Research Article: New Research

  • Paroxetine Increases δ Opioid Responsiveness in Sensory Neurons
  • Enhanced Stability of Complex Sound Representations Relative to Simple Sounds in the Auditory Cortex
  • Extrahippocampal Seizure and Memory Circuits Overlap
Show more Research Article: New Research

Development

  • Neurofilament transport is bidirectional in vivo
  • Gestational Buprenorphine Exposure Disrupts Dopamine Neuron Activity and Related Behaviors in Adulthood
  • Differential Effects of the G-Protein-Coupled Estrogen Receptor (GPER) on Rat Embryonic (E18) Hippocampal and Cortical Neurons
Show more Development

Subjects

  • Development

  • Home
  • Alerts
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Latest Articles
  • Issue Archive
  • Blog
  • Browse by Topic

Information

  • For Authors
  • For the Media

About

  • About the Journal
  • Editorial Board
  • Privacy Policy
  • Contact
  • Feedback
(eNeuro logo)
(SfN logo)

Copyright © 2022 by the Society for Neuroscience.
eNeuro eISSN: 2373-2822

The ideas and opinions expressed in eNeuro do not necessarily reflect those of SfN or the eNeuro Editorial Board. Publication of an advertisement or other product mention in eNeuro should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in eNeuro.