Extended Data Figure 2
Creation and validation of the C1qa KO mouse. A conditional C1qa mouse was created as part of the Knockout Mouse Project (KOMP) at The Jackson Labs (https://www.jax.org/research-and-faculty/tools/knockout-mouse-project). (A) Representation of the C1qa alleles that are available including C1qaTm1a (LacZ reporter), C1qaTm1c (floxed allele), C1qaTm1d (null allele). As has been shown for other KOMP alleles, the Tm1a allele is not capable of reporting C1qa expression using the β-galactosidase assay. Mating the C1qaTm1a mice to mice carrying FLP recombinase creates the C1qaTm1c floxed allele. Mating the C1qaTm1c mice to mice carrying CRE recombinase creates the C1qaTm1d null allele. Cell-specific ablation of C1qa can be achieved using a cell-specific Cre line. The locations of genotyping primers are shown as inward facing arrows. (B) Examples of genotyping assays for the different alleles and band sizes. Primers pairs in this example were as follows. C1qa+: F – CCGGAAGAAAAGACATCCTG; R – CTTTCACGCCCTTCAGTCCT. C1qaTm1a: F – GTGGTTTGTCCAAACTCATCAA; R – TCTCTGAGCCTCTGCTTCAA. C1qaTm1c: F – GGACGAGAGGGGAGGAGTTA; R – TTAGGACCCTTTGGCACAAC. C1qaTm1d: F – CCGGAACCGAAGTTCCTATT; R – AGACGGGGATCGTTTATTCC. Note that the C1qa+ primers amplify a larger product in mice carrying the C1qaTm1c allele. Standard PCR conditions were used with an annealing temperature of 59.3oC for C1qa+, C1qaTm1b and C1qaTm1d and 61.0oC for C1qaTm1c. (C) RNA in situ hybridization to visualize C1qa transcripts in brains sections from C1qa+/+ and C1qaTm1d/Tm1d mice. As expected, C1qa expression is absent in C1qaTm1d/Tm1d (C1qa KO) mice. Download Extended Data Figure 2, DOCX file