Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT

User menu

Search

  • Advanced search
eNeuro
eNeuro

Advanced Search

 

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT
PreviousNext
Research ArticleResearch Article: Theory/New Concepts, Disorders of the Nervous System

Pericyte-Mediated Tissue Repair through PDGFRβ Promotes Peri-Infarct Astrogliosis, Oligodendrogenesis, and Functional Recovery after Acute Ischemic Stroke

Tomoya Shibahara, Tetsuro Ago, Kuniyuki Nakamura, Masaki Tachibana, Yoji Yoshikawa, Motohiro Komori, Kei Yamanaka, Yoshinobu Wakisaka and Takanari Kitazono
eNeuro 11 February 2020, 7 (2) ENEURO.0474-19.2020; https://doi.org/10.1523/ENEURO.0474-19.2020
Tomoya Shibahara
Department of Medicine and Clinical Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Tomoya Shibahara
Tetsuro Ago
Department of Medicine and Clinical Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Tetsuro Ago
Kuniyuki Nakamura
Department of Medicine and Clinical Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Kuniyuki Nakamura
Masaki Tachibana
Department of Medicine and Clinical Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yoji Yoshikawa
Department of Medicine and Clinical Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Motohiro Komori
Department of Medicine and Clinical Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kei Yamanaka
Department of Medicine and Clinical Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yoshinobu Wakisaka
Department of Medicine and Clinical Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Yoshinobu Wakisaka
Takanari Kitazono
Department of Medicine and Clinical Science, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Takanari Kitazono
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Extended Data
  • Figure1
    • Download figure
    • Open in new tab
    • Download powerpoint
  • Figure 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1.

    Reduction of MAP2-negative areas and infarct volume in the subacute phase is attenuated in Pdgfrb+/– mice. A, MAP2 staining on days 1, 7, 14, and 28 after pMCAO in wild-type and Pdgfrb+/– mice (scale bar, 500 μm). B, Quantification of MAP2-negative areas on days 1, 7, 14, and 28 after pMCAO (n = 6, each group). C, Quantification of infarct volume on days 1, 7, 14, and 28 after pMCAO (n = 6, each group). D, Quantification of tissue atrophy on day 28 after pMCAO (n = 6, each group). Data are shown as the mean ± SEM. B, D, *p < 0.05 and **p < 0.01, unpaired t test. C, *p < 0.05, one-way ANOVA followed by Bonferroni’s post hoc test. n.s.: not significant.

  • Figure 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2.

    Leptomeningeal arteriogenesis and recovery of CBF in ischemic areas after pMCAO are attenuated in Pdgfrb+/– mice. A, Images of CBF just under the cortical surface, as assessed by laser speckle flowmetry, in control and on days 1, 7, 14, and 28 after pMCAO in wild-type and Pdgfrb+/– mice (scale bar, 2 mm). B, Temporal profiles of CBF quantification on days 1, 7, 14, and 28 after pMCAO (n = 12, each group). C, Macroscopic images of leptomeningeal anastomoses, assessed by a latex perfusion method, at baseline (a, c) and on day 7 (b, d) after pMCAO in wild-type and Pdgfrb+/– mice (scale bar, 50 μm). Arrowheads indicate the leptomeningeal anastomoses vessels (b, d). Magnified images of the dotted squares (e–h) in a–d are shown in the right panels. Cortical whole mount immunostaining of leptomeningeal anastomoses with CD31 (red) on day 7 after pMCAO is shown in i (a: artery, v: vein). Arrows indicate the pre-existing ACA and MCA. The magnified image of the yellow dotted square (j) is shown in the right panel. Double immunofluorescence labeling with CD31 (red) and αSMA (green) in anastomosed vessels on day 7 after pMCAO in wild-type (j) and Pdgfrb+/– mice (k) is shown (scale bar, 50 μm). D, Diameter of anastomotic vessels at baseline and on day 7 after pMCAO (baseline, n = 7 each group; pMCAO, n = 8 each group). E, Number of anastomotic vessels at baseline and on day 7 after pMCAO (baseline, n = 7 each group; pMCAO, n = 8 each group). F, mRNA levels of arteriogenesis-related genes in non-infarct hemisphere and ischemic hemisphere on day 7 (n = 8, each group). G, Cortical whole mount immunostaining with CD31 (red), F4/80 (green), and DAPI (blue) in wild-type and Pdgfrb+/– mice (scale bar, 50 μm). H, Quantitative PCR for Ccl2/Mcp1 and Tnfa in cultured VSMCs at baseline (black), with PDGF-BB (10 ng/ml; red), and with SU16f-pretreated PDGF-BB (100 nmol/l; blue; n = 6, each group). Data are shown as the mean ± SEM. B, F, †p < 0.1, *p < 0.05, **p < 0.01, and ***p < 0.001, unpaired t test. D–E, H, †p < 0.1, *p < 0.05, **p < 0.01, and ***p < 0.001, one-way ANOVA followed by Bonferroni’s post hoc test.

  • Figure 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3.

    PDGFRβ is important for intrainfarct angiogenesis and fibrosis. A, Immunohistochemistry of PDGFRβ at baseline and on days 1, 7, 14, and 28 after pMCAO (scale bar, 500 μm). Magnified images in the squares are shown at the bottom. B, Immunohistochemistry of CD13, a marker of pericyte and pericyte-derived cells, in control and on days 7, 14, and 28 after pMCAO (scale bar, 500 μm). C, Quantification of CD13-positive areas in control and on days 7, 14, and 28 after pMCAO in wild-type and Pdgfrb+/– mice (n = 6, each group). D, Representative macroscopic observation of the brain surface on day 28 after pMCAO (n = 10). E, Fibrin staining on day 28 after pMCAO (scale bar, 100 μm). F, Quantification of fibrin-positive areas in mice on day 28 after pMCAO and in sham-operated mice (n = 6, each group). G, Representative macroscopic images of Evans blue dye leakage in the brain on day 28 after pMCAO (n = 6). H, Immunofluorescence labeling of CD31 on day 28 after pMCAO in wild-type (a) and Pdgfrb+/– mice (d; scale bar, 300 μm). Magnified images in the dotted squares (b, c, e, f) are shown to the right. I, Quantification of intrainfarct CD31 density in mice on day 28 after pMCAO and in sham-operated mice (n = 8, each group). J, Quantitative PCR of genes expressed in non-infarct control and within infarct areas on days 7 and 14 after pMCAO in wild-type (black) and Pdgfrb+/– mice (blue; n = 8, each group). Data are shown as the mean ± SEM. C, F, I, *p < 0.05, and **p < 0.01, unpaired t test. J, *p < 0.05, **p < 0.01, and ***p < 0.001, one-way ANOVA followed by Bonferroni’s post hoc test.

  • Figure 4.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 4.

    Pericyte-astrocyte interaction in peri-infarct areas after pMCAO. A, Immunohistochemistry for GFAP (scale bar, 500 μm) and quantification of GFAP-positive areas on day 28 after pMCAO in wild-type and Pdgfrb+/– mice (n = 6, each group). B, Double immunofluorescence labeling of GFAP (red) and PDGFRβ (green; scale bar, 20 μm) on day 28 after pMCAO. PDGFRβ-positive fibrotic lesion and GFAP-positive astrogliosis form a clear boundary. C, Experimental scheme for phenotypic changes induced in astrocytes by pericyte culture medium (black, control), PCM treated with PBS (blue, PCM/PBS) or PDGF-BB (10 ng/ml; red, PCM/PDGF-BB). D, MTT assay for astrocytes after treatment with PCM for 24 h (n = 6, each group). E, Astrocyte proliferation assay as assessed by immunofluorescence of EdU after treatment with PCM for 24 h (n = 6, each group). F, Astrocyte scratch assay after treatment with PCM for 72 h (scale bar, 200 μm; left). Quantification of wound recovery (n = 5, each group). G, Immunoblot analyses of STAT3 and phospho-STAT3, AKT and phospho-AKT, and ERK and phospho-ERK in astrocytes after treatment with CM for 30 min (n = 5, each group). H, Representative immunofluorescence labeling for pSTAT3 (green) and GFAP (red), and DAPI (blue) in the peri-infarct area after pMCAO in wild-type and Pdgfrb+/– mice on day 28 (scale bar, 50 μm). Quantification of the number of pSTAT3 and GFAP double-positive cells are evaluated (n = 5, each group). I, Double immunofluorescence labeling of NG2 (red) and IL6 (green; scale bar, 10 μm) on day 7 after pMCAO. J, Quantitative PCR of Il6 expression in non-infarct hemisphere and within infarct areas on days 7 and 14 after pMCAO in wild-type (black) and Pdgfrb+/– mice (blue; n = 8, each group). K, Expression change of Il6 in pericytes treated with PDGF-BB in the presence or absence of SU16f (n = 4, each group). L, MTT assay for astrocytes treated with PCM in the presence of anti-IL6 antibody (10–40 ng/ml; n = 6, each group). Data are shown as the mean ± SEM. A, H, J, *p < 0.05, and **p < 0.01, unpaired t test. D–G, K, L, †p < 0.1, *p < 0.05, **p < 0.01, and ***p < 0.001; $p < 0.05 and $$p < 0.01 versus control IgG with PCM/PBS; and #p < 0.05 and ##p < 0.01 versus control IgG with PCM/PDGF-BB, one-way ANOVA followed by Bonferroni’s post hoc test.

  • Figure 5.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 5.

    Peri-infarct oligodendrogenesis but not neurogenesis is attenuated in Pdgfrb+/– mice. A, Immunohistochemistry for DCX in the SVZ and striatum on day 28 after pMCAO in wild-type and Pdgfrb+/– mice (scale bar, 150 μm). B, Quantification of the DCX-positive areas in the ipsilateral and contralateral hemisphere on days 14 and 28 after pMCAO in wild-type (black) and Pdgfrb+/– mice (blue; n = 6, each group). C, Double immunofluorescence labeling of NeuN (green) and EdU (red) in the peri-infarct areas on day 28 after pMCAO and in sham-operated mice. Arrowheads indicate NeuN and EdU double-positive newborn mature neurons (scale bar, 50 μm). D, Quantification of the number of double-positive cells in peri-infarct areas on day 28 after pMCAO and in sham-operated mice (n = 8, each group). E, Immunohistochemistry for OLIG2 in sham-operated mice and in peri-infarct areas on day 28 after pMCAO in wild-type and Pdgfrb+/– mice (scale bar, 100 μm). F, Quantification of the number of OLIG2-positive cells in peri-infarct areas on days 1, 7, 14, and 28 after pMCAO in wild-type (black) and Pdgfrb+/– mice (blue; n = 6, each group). G, Immunohistochemistry for APC in sham-operated mice and in peri-infarct areas on day 28 after pMCAO (scale bar, 100 μm). H, Quantification of the number of APC-positive cells in peri-infarct areas on day 28 after pMCAO (n = 6, each group). I, Triple immunofluorescence labeling with APC (green), GFAP (red) and MBP (blue) in peri-infarct areas (striatum) on day 28 after pMCAO. Magnified images of the dotted square are shown below and in the right panel (scale bar, 50 μm). J, Double immunofluorescence labeling of GSTπ (green) and EdU (red) in sham-operated mice and in the peri-infarct areas on day 28 after pMCAO. Arrowheads indicate GSTπ and EdU double-positive newborn mature OLs (scale bar, 40 μm). K, Quantification of the number of double-positive cells in peri-infarct areas on day 28 after pMCAO (n = 8, each group). L, Double immunofluorescence labeling of MBP (green) and the pan-axonal neurofilament marker, SMI312 (red), in sham-operated mice and in peri-infarct striatum on day 28 after pMCAO (scale bar, 50 μm). M, Quantification of MBP/SMI312 ratio in the peri-infarct striatum on day 28 after pMCAO (n = 7, each group). Data are shown as the mean ± SEM. B, D, H, K, M, *p < 0.05 and **p < 0.01, unpaired t test. F, #p < 0.05 and ###p < 0.001 vs. control wild-type mice, $$p < 0.01 and $$$p < 0.001 vs. control Pdgfrb+/– mice, one-way ANOVA followed by Bonferroni’s post-hoc test. n.s.: not significant.

  • Figure 6.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 6.

    Astrocytes stimulated with PCM promote differentiation and myelination. A, An experimental scheme for OPC differentiation in normal culture medium (control) or in astrocyte culture CM pretreated with empty pericyte medium, PCM/PBS, or PCM/PDGF-BB. B, Quantitative PCR of Mbp, Mag, and Plp in OPCs stimulated with CM for 5 d (n = 4, each group). C, Double immunofluorescence labeling of MBP (green) and OLIG2 (red) in cultured OPCs treated with ACM for 7 d (n = 5, each group; scale bar, 100 μm). D–F, Quantification of the number of MBP-positive cells among OLIG2-positive cells (D), MBP-positive areas (E), and OLIG2-positive cells (F). G, Quantitative PCR for Gfap, Ctnnb1, Bdnf, and Igf1 in astrocytes treated with PCM for 24 h (n = 6, each group). Data are shown as the mean ± SEM. B, D–G, †p < 0.1, *p < 0.05, **p < 0.01, and ***p < 0.001, one-way ANOVA followed by Bonferroni’s post hoc test. n.s.: not significant.

  • Figure 7.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 7.

    Functional recovery after pMCAO was attenuated in Pdgfrb+/– mice. A, Experimental schedule for neurological assessment. Neurological function was assessed by (B) rotarod test, (C) mNSS test, and (D) cylinder test at baseline and days 1, 3, 7, 14, 21, and 28 after pMCAO in wild-type (black) and Pdgfrb+/– mice (blue). Data are shown as the mean ± SEM (n = 8, each group, *p < 0.05, and **p < 0.01, unpaired t test).

  • Figure 8.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 8.

    Post-stroke phenotypic changes in female Pdgfrb+/– mice. A, MAP2 staining on days 1 and 28 after pMCAO in female wild-type and Pdgfrb+/– mice (scale bar, 500 μm). Quantification of MAP2-negative areas and infarct volume (n = 6, each group). Data are shown as the mean ± SEM (*p < 0.05 and **p < 0.01, unpaired t test). B, Representative laser speckle images of CBF after pMCAO in female wild-type and Pdgfrb+/– mice on day 28 (n = 9, each group). Scale bar, 2 mm. Data represent the mean ± SEM (***p < 0.001, unpaired t test). C, Representative CD13 staining (scale bar, 500 μm) and quantification on day 28 after pMCAO in female wild-type and Pdgfrb+/– mice (n = 6, each group). Data are shown as the mean ± SEM (***p < 0.001, unpaired t test). D, Representative GFAP staining (scale bar, 500 μm) and quantification on day 28 after pMCAO in wild-type and Pdgfrb+/– female mice (n = 6, each group). Data are shown as the mean ± SEM (*p < 0.05, unpaired t test). E, Representative APC staining (scale bar, 100 μm) and quantification on day 28 after pMCAO in female wild-type and Pdgfrb+/– mice (n = 6, each group). Data are shown as the mean ± SEM (*p < 0.05, unpaired t test). F, Neurological scores in female mice after pMCAO (n = 9, each group). Data represent the mean ± SEM (†p < 0.1, *p < 0.05, and **p < 0.01, unpaired t test).

  • Figure 9.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 9.

    Schematic diagram of pericyte-mediated tissue repair and functional recovery after pMCAO. Schematic diagram of this study. PDGFRβ signaling in vascular mural cells plays important roles in mediating post-stroke leptomeningeal arteriogenesis and intrainfarct angiogenesis leading to the recovery of CBF in ischemic areas. After recruitment around endothelial cell (EC) tubes, PDGFRβ-positive pericytes transdifferentiate into fibrotic cells, enhance tissue repair within infarct areas and astrogliosis in peri-infarct areas, and promote peri-infarct oligodendrogenesis (which together is OPC differentiation and myelination) leading to functional recovery. ECM, extracellular matrix.

Tables

  • Figures
  • Extended Data
    • View popup
    Table 1.

    Primers used for PCR

    Target geneForward primer (5′-3′)Reverse primer (5′-3′)
    Mouse primer sequences
    Adgre1 TCTGCAGTGTCAGCTCAGAA GAAGTCTGGGAATGGGAGCT
    αSMA CTGACAGAGGCACCACTGAA CATCTCCAGAGTCCAGCACA
    Bdnf GGTATCCAAAGGCCAACTGA CTTATGAATCGCCAGCCAAT
    Ccl2/Mcp1 CCAAATGAGATCAGAACCTACAACT CTAGTTCACTGTCACACTGGTCACT
    Cd31 TGCAGGAGTCCTTCTCCACT ACGGTTTGATTCCACTTTGC
    Cldn5CTGGACCACAACATCGTGACGCCGGTCAAGGTAACAAAGA
    Ctnnb1 AGGGTGCTATTCCACGACTA CACCCTTCTACTATCTCCTCCAT
    Desmin GACATCCGGGCTCAGTATGA CGCGCAATGTTGTCCTGATA
    Fgf2GGCTGCTGGCTTCTAAGTGTCCGTTTTGGATCCGAGTTTA
    Fn1 AATGGAAAAGGGGAATGGAC CTCGGTTGTCCTTCTTGCTC
    Gfap AAGGTTGAATCGCTGGAGGA AAGGTTGAATCGCTGGAGGA
    Igf1 TGGATGCTCTTCAGTTCGTG GTCTTGGGCATGTCAGTGTG
    Mag TGCTCACCAGCATCCTCACG AGCAGCCTCCTCTCAGATCC
    Mbp TACCTGGCCACAGCAAGTAC GTCACAATGTTCTTGAAG
    Ntf3 GATCCAGGCGGATATCTTGA AGCGTCTCTGTTGCCGTAGT
    Pdgfb GGCCACACACCTTCTCTGAT GTGGAGGAGCAGACTGAAGG
    Pdgfrb CACCTTCTCCAGTGTGCTGA GGAGTCCATAGGGAGGAAGC
    Plp GTATAGGCAGTCTCTGCGCTGAT AAGTGGCAGCAATCATGAAGG
    Tnfa CGTCAGCCGATTTGCTATCT CGGACTCCGCAAAGTCTAAG
    Zo1 GGGCCATCTCAACTCCTGTA AGAAGGGCTGACGGGTAAAT
    18s rRNA AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA
    Human primer sequences
    Ccl2/Mcp1 GATCTCAGTGCAGAGGCTCG TGCTTGTCCAGGTGGTCCAT
    Il6 GAACTCCTTCTCCACAAGCG TTTTCTGCCAGTGCCTCTTT
    Tnfa CACTAAGAATTCAAACTGGGGC GAGGAAGGCCTAAGGTCCAC
    Pdgfrb AGGTGGTTGCACATTTGTCCAG TGTGCAGCTGTGTTCTTGAGAC
    18s rRNA AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA
    • View popup
    Table 2.

    Physiological data

    Base13714
    Wild typeSBP115 ± 798 ± 7122 ± 10122 ± 9117 ± 9
    Pdgfrb+/–mmHg114 ± 6101 ± 13117 ± 13118 ± 12117 ± 12
    Wild typeDBP62 ± 1056 ± 1167 ± 967 ± 765 ± 9
    Pdgfrb+/–mmHg63 ± 558 ± 1464 ± 1461 ± 1461 ± 7
    Wild typeHR551 ± 71527 ± 106558 ± 89616 ± 68616 ± 83
    Pdgfrb+/–bpm572 ± 64488 ± 76556 ± 46572 ± 55643 ± 51

Extended Data

  • Figures
  • Tables
  • Extended Data Figure 1-1

    Baseline expression of PDGFRβ is decreased in the brain in Pdgfrb+/– mice. Immunoblot analysis demonstrates the baseline decrease in PDGFRβ expression by ∼80% in the brain in Pdgfrb+/– mice compared with wild-type mice (n = 4 mice per group). β-Actin is used as a loading control. Data represent the mean ± SEM (***p < 0.001, unpaired t test). Download Figure 1-1, DOCX file.

  • Extended Data Figure 1-2

    Immunoblot analyses of PDGFRβ and cell-specific genes in cultured cells. Immunoblot analyses of PDGFRβ, GFAP, NeuN, and β-actin in cultured pericytes, astrocytes, and cortical neurons. Primary cortical neurons were isolated from ICR mice at embryonic day 17 (E17) as described previously (Nakashima et al., 2018).Download Figure 1-2, DOCX file.

  • Extended Data Figure 1-3

    Body weight recovery after pMCAO is suppressed in Pdgfrb+/– mice. The graph shows body weight changes in wild-type and Pdgfrb+/– mice at the indicated days after pMCAO (n = 12, each group). Data represent the mean ± SEM (†p < 0.1, **p < 0.01 and ***p < 0.001, unpaired t test). Download Figure 1-3, DOCX file.

  • Extended Data Figure 4-1

    Localization and extent of IBA1-positive microglia/macrophage on day 28 after pMCAO. A, Representative IBA1 staining on day 28 after pMCAO in wild-type (left) and Pdgfrb+/– (right) mice. Scale bar, 500 μm. B, Quantification of the number of IBA1-positive cells in peri-infarct areas on day 28 after pMCAO in wild-type (black) and Pdgfrb+/– mice (blue; n = 6, each group; p = 0.465, unpaired t test). C, Representative immunofluorescence labeling for IBA1 (green) and PDGFRβ (red), and DAPI (blue) in peri-infarct area on day 28 after pMCAO in wild-type mice (Scale bar, 10 μm). Data represent the mean ± SEM. Download Figure 4-1, DOCX file.

  • Extended Data Figure 4-2

    IL6 expression within infarct area after pMCAO. Double immunofluorescence labeling of and IL6 (green) and (A) F4/80 (red), a marker of macrophage (scale bar, 5 μm), or (B) CD31 (red), a marker of endothelial cell (scale bar, 10 μm), on day 7 after pMCAO. Download Figure 4-2, DOCX file.

  • Extended Data Figure 5-1

    White matter injury after pMCAO is comparable between wild-type and Pdgfrb+/– mice. A, B, Representative Klüver–Barrera (KB) staining on day 1 after pMCAO in wild-type and Pdgfrb+/– mice (scale bar, 500 μm). C, D, Magnified images of peri-infarct striatum are shown (scale bar, 100 μm). E, F, The extent of white matter injury is assessed by KB-positive area in striatum and corpus callosum against that of the contralateral hemisphere (n = 6, each group, unpaired t test). Data represent the mean ± SEM. Download Figure 5-1, DOCX file.

  • Extended Data Figure 6-1

    Effects of PCM on OPC differentiation and myelination. A, Double immunofluorescence labeling of MBP (green) and OLIG2 (red) in cultured OPC treated with PCM for 7 d (n = 5, each group; scale bar, 100 μm). B, An experimental scheme for OPC differentiation in normal culture medium (control) or in PCM treated with PBS (blue, PCM/PBS) or PDGF-BB (10 ng/ml; red, PCM/PDGF-BB). C, D, Quantification of the number of MBP-positive cells within OLIG2-positive OPCs and MBP-positive areas. Data represent the mean ± SEM (*p < 0.05, **p < 0.01, and ***p < 0.001 one-way ANOVA followed by Bonferroni’s post hoc test). Download Figure 6-1, DOCX file.

Back to top

In this issue

eneuro: 7 (2)
eNeuro
Vol. 7, Issue 2
March/April 2020
  • Table of Contents
  • Index by author
  • Ed Board (PDF)
Email

Thank you for sharing this eNeuro article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Pericyte-Mediated Tissue Repair through PDGFRβ Promotes Peri-Infarct Astrogliosis, Oligodendrogenesis, and Functional Recovery after Acute Ischemic Stroke
(Your Name) has forwarded a page to you from eNeuro
(Your Name) thought you would be interested in this article in eNeuro.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
Pericyte-Mediated Tissue Repair through PDGFRβ Promotes Peri-Infarct Astrogliosis, Oligodendrogenesis, and Functional Recovery after Acute Ischemic Stroke
Tomoya Shibahara, Tetsuro Ago, Kuniyuki Nakamura, Masaki Tachibana, Yoji Yoshikawa, Motohiro Komori, Kei Yamanaka, Yoshinobu Wakisaka, Takanari Kitazono
eNeuro 11 February 2020, 7 (2) ENEURO.0474-19.2020; DOI: 10.1523/ENEURO.0474-19.2020

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Share
Pericyte-Mediated Tissue Repair through PDGFRβ Promotes Peri-Infarct Astrogliosis, Oligodendrogenesis, and Functional Recovery after Acute Ischemic Stroke
Tomoya Shibahara, Tetsuro Ago, Kuniyuki Nakamura, Masaki Tachibana, Yoji Yoshikawa, Motohiro Komori, Kei Yamanaka, Yoshinobu Wakisaka, Takanari Kitazono
eNeuro 11 February 2020, 7 (2) ENEURO.0474-19.2020; DOI: 10.1523/ENEURO.0474-19.2020
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Visual Abstract
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
    • Synthesis
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • astrocyte
  • neurorestoration
  • oligodendrogenesis
  • pericyte
  • platelet-derived growth factor receptor β
  • repair

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

Research Article: Theory/New Concepts

  • Decoding Task-Specific Cognitive States with Slow, Directed Functional Networks in the Human Brain
  • Shunting Inhibition Improves Synchronization in Heterogeneous Inhibitory Interneuronal Networks with Type 1 Excitability Whereas Hyperpolarizing Inhibition Is Better for Type 2 Excitability
  • Poor Concordance of Floxed Sequence Recombination in Single Neural Stem Cells: Implications for Cell Autonomous Studies
Show more Research Article: Theory/New Concepts

Disorders of the Nervous System

  • Decoding Task-Specific Cognitive States with Slow, Directed Functional Networks in the Human Brain
  • Shunting Inhibition Improves Synchronization in Heterogeneous Inhibitory Interneuronal Networks with Type 1 Excitability Whereas Hyperpolarizing Inhibition Is Better for Type 2 Excitability
  • Poor Concordance of Floxed Sequence Recombination in Single Neural Stem Cells: Implications for Cell Autonomous Studies
Show more Disorders of the Nervous System

Subjects

  • Disorders of the Nervous System
  • Home
  • Alerts
  • Follow SFN on BlueSky
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Latest Articles
  • Issue Archive
  • Blog
  • Browse by Topic

Information

  • For Authors
  • For the Media

About

  • About the Journal
  • Editorial Board
  • Privacy Notice
  • Contact
  • Feedback
(eNeuro logo)
(SfN logo)

Copyright © 2026 by the Society for Neuroscience.
eNeuro eISSN: 2373-2822

The ideas and opinions expressed in eNeuro do not necessarily reflect those of SfN or the eNeuro Editorial Board. Publication of an advertisement or other product mention in eNeuro should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in eNeuro.