Article Figures & Data
Figures
- Figure 1.
Properties of Cx36-GCaMP. A, Intrinsic fluorescence of Cx36-GCaMP expressed in HEK293 cells. Cx36-GCaMP assembles into gap junctions at cell-cell boundaries. B, Tracer coupling measurements of Cx36-GCaMP expressed in HeLa cells. Bi, Neurobiotin loading and diffusion from the scraped edge in cells in control conditions (Con) or treated with 10 μM PKA inhibitor (Rp) or 10 μM PKA activator (Sp). Bii, Fits of linear compartmental diffusion model to Cy-3 streptavidin fluorescent labeling of Neurobiotin tracer for each of the images shown. Diffusion coefficient k determined from the fit, in cells2/s, is shown on each graph. C, Mean (bars) diffusion coefficients (k) for Neurobiotin tracer coupling in HeLa cells transfected with EGFP, Cx36-EGFP, or Cx36-GCaMP. All data are shown for six (EGFP, Cx36-GCaMP) or three (Cx36-EGFP) experiments. Error bars show 95% confidence limits of the mean; ****p < 0.0001 versus control.
- Figure 2.
Calcium responses of Cx36-GCaMP. A, Fluorescence response to application of 5 μM ionomycin for 40 s (black bar). Data shown are means of 15 gap junctions in three experiments ± 95% confidence limits of the mean. Note that one of three experiments ended at 92 s, so the final 28 s show 10 gap junctions. B, Fluorescence response to application of 100 nM thapsigargin (gray bar). Data shown are means of five gap junctions in one experiment ± 95% confidence limits of the mean. C, Fluorescence response to application of 5 μM ionomycin (black bar) in the presence of 100 nM thapsigargin. Shown are means of 15 gap junctions in three experiments ± 95% confidence limits of the mean. The mean response to ionomycin in control conditions is shown by the black line for reference. D, Fluorescence response to application of 5 μM ionomycin (black bar) in the presence of 200 nM SEA 0400. Shown are means of 14 gap junctions in three experiments ± 95% confidence limits of the mean. The mean response to ionomycin in control conditions is shown by the black line for reference.
- Figure 3.
Immunofluorescence labeling of Cx36-GCaMP and NMDA receptors transfected into HEK293 cells. For each transfection combination, Cx36-GCaMP is shown in green, NR1 in red, and NR2x in blue. A, Cx36-GCaMP + NR1. B, Cx36-GCaMP + NR1 + NR2A. C, Cx36-GCaMP + NR1 + NR2B. D, Cx36-GCaMP + NR1 + NR2C. Well-formed gap junctions at cell-cell boundaries were used for live imaging experiments, while overexpressing cells with diffusely distributed Cx36-GCaMP were avoided.
- Figure 4.
Cx36-GCaMP gap junction responses to glutamate application. Shown in A–C are representative single gap junction raw fluorescence responses to bath application of 100 μM glutamate (black bar) in HEK293 cells expressing NMDA receptors containing NR1 and NR2A (A), NR2B (B), or NR2C (C). Baseline subtracted average responses to 30 μM (dashed lines) and 100 μM (solid lines) glutamate are shown below in D–F. D, 30 μM NR2A, average of eight gap junctions from two experiments; 100 μM NR2A, average of five gap junctions from one experiment. E, 30 μM NR2B, average of seven gap junctions from two experiments; 100 μM NR2B, average of four gap junctions from one experiment. F, 30 μM NR2C, average of six gap junctions from two experiments; 100 μM NR2C, average of 11 gap junctions from three experiments.
- Figure 5.
Glutamate concentration-response relationships of Cx36-GCaMP gap junctions in HEK293 cells expressing NR2A-containing and NR2B-containing NMDA receptors. A, B, Baseline-subtracted fluorescence peak response for NR2A (A) and NR2B-containing (B) cells. C, D, Integrated area under the response curve for NR2A (C) and NR2B-containing (D) cells. All data are shown for 8–25 gap junctions from two to eight experiments per condition. The black lines connect the mean responses.
- Figure 6.
Effects of glutamate application on tracer coupling in HeLa cells expressing EGFP or Cx36-GCaMP with or without added NMDA receptor subunits. The diffusion coefficient (k) for Neurobiotin tracer diffusion is shown for 5-min preincubation plus 10-min tracer diffusion time in control media (Con) or control media plus 100 μM glutamate (100 Glu). All data are shown from three experiments; bars show mean values; error bars show 95% confidence limits of the mean; **p < 0.01, ****p < 0.0001 versus same transfection composition in control media.
- Figure 7.
Pharmacological characteristics of endogenous glutamate receptors in HeLa cells expressing Cx36-GCaMP. The diffusion coefficient (k) for Neurobiotin tracer diffusion is shown for 5-min preincubation plus 10-min tracer diffusion time in control media (Con), control media plus 100 μM glutamate (Glu), or control media plus 100 μM glutamate plus 100 nM ACET (Glu+ACET), 10 μM CNQX (Glu+CNQX), 40 μM GYKI 53 655 (Glu+GYKI), or 10 μM CPP (Glu+CPP). All data are shown from six (Con, Glu) or three experiments; bars show mean values; error bars show 95% confidence limits of the mean; *p < 0.05, ****p < 0.0001 versus control condition; comparison of each drug versus 100 μM Glu, shown by the bracket, yielded p < 0.0001 for all.
- Figure 8.
Protein kinase signaling pathways responsible for potentiation of Cx36-GCaMP tracer coupling by 100 μM glutamate in HeLa cells. The diffusion coefficient (k) for Neurobiotin tracer diffusion is shown using the same experimental paradigm as in Fig. 6. Rp = PKA inhibitor (10 μM); KN-93 = CaMKII inhibitor (10 μM); Glu = 100 μM glutamate. All data are shown from three experiments; bars show mean values; error bars show 95% confidence limits of the mean; *p < 0.05, ****p < 0.0001; ns = not significant. Symbols above bars represent comparison versus same transfected construct in control media; symbols above brackets represent comparison of the conditions underlying the ends of the brackets.
Tables
Name Sequence Template Cx36-EGFP and GCaMP cloning T7 extended GTAATACGACTCACTATAGGGCGAA MsCx36 cDNA JOB 284 CCAAACTTGGGTACCCACACATAGGC MsCx36 cDNA JOB 285 CCAAACCTTTGATCACACACATAGGC MsCx36 cDNA PB513B-1 modification KBM 1 AATTAATGACCTGCAGGTCGACGACTGCATAGGGTTAC pIRES DsRedT3-KR24 KBM 2 GCCGGGATTCTCCTCCACGATCCATTATCATCGTGTTTTTCAA pIRES DsRedT3-KR24 KBM 3 CGCGCCCGCCGCCCTA PB513B-1 KBM 4 TGCAGGTCATTAATTAAGGTGGCGTCTAGCGTAGGCG PB513B-1 Cx36-GCaMP – NR1 dual vector cloning KBM 7 AGCGAATTCGAATTTCAGCGATGGGGGAATGG Cx36-GCaMP KBM 8 CCGCGGATCCGATTTTACGCCTTAAGATACATTGATGAGTT Cx36-GCaMP KBM 405 AGACGCCACCTTAATTAACGGAGCTCATGAGCACCATG NR1 KBM 406 ATGCAGTCGTCGACCTGCAGGTCCTCAGCTCTCCCTATGACGG NR1 NR2 cloning KBM 11 GCTAGCGAATTCGAATTTCTCTCCACAGGTGTCCACTCC NR2C KBM 12 CGGCCGCGGATCCGATTTGGTGCTGCGCCGAATTA NR2C KBM 13 GCTAGCGAATTCGAATTTGCTAGCGGCAGATTGGG NR2A KBM 14 CGGCCGCGGATCCGATTTCCAGCTGGTTCTTTCCGC NR2A KBM 15 GCTAGCGAATTCGAATTTGTGGTGGGCTGAAGACTCCTTA NR2B KBM 16 CGGCCGCGGATCCGATTTCCATAGAGCCCACCGCATC NR2B Test/comparison Multiple comparison/effect size 95% CI of effect size p n1 exps 1 n2 exps 2 Figure 1 Two-way ANOVA Tukey EGFP Rp vs Con 5.690 e-005 0.0002499 to –0.0001361 0.7662 29 6 29 6 EGFP Sp vs Con –1.034 e-005 0.0001827 to –0.0002033 0.9912 29 6 29 6 Cx36-EGFP Rp vs Con 0.0007820 0.001050 to 0.0005136 <0.0001 15 3 15 3 Cx36-EGFP Sp vs Con –9.667e-005 0.0001717 to –0.0003650 0.6722 15 3 15 3 Cx36-GCaMP Rp vs Con 0.0009282 0.001120 to 0.0007368 <0.0001 29 6 30 6 Cx36-GCaMP Sp vs Con 0.0001067 0.0002964 to –8.309e-005 0.3819 30 6 30 6 Two-way ANOVA Dunnett Cx36-EGFP vs EGFP Con 6.494e-005 0.0002863 to –0.0001564 0.7451 15 3 29 6 Cx36-GCaMP vs EGFP Con 0.0002149 0.0003962 to 3.368e-005 0.0167 30 6 29 6 Cx36-EGFP vs EGFP Rp 0.0007900 0.001011 to 0.0005686 <0.0001 15 3 29 6 Cx36-GCaMP vs EGFP Rp 0.001086 0.001269 to 0.0009034 <0.0001 29 6 29 6 Cx36-EGFP vs EGFP Sp –2.138e-005 0.0002000 to –0.0002428 0.9680 15 3 29 6 Cx36-GCaMP vs EGFP Sp 0.0003320 0.0005132 to 0.0001507 0.0001 30 6 29 6 Figure 6 Two-way ANOVA Tukey EGFP 100 Glu vs Con 0.0001200 0.0008372 to –0.0005972 0.9996 15 3 15 3 Cx36-GCaMP 100 Glu vs Con 0.001400 0.002117 to 0.0006828 <0.0001 15 3 15 3 Cx36, NR1 100 Glu vs Con 0.0008867 0.001604 to 0.0001695 0.0052 15 3 15 3 Cx36, NR1, NR2A 100 Glu vs Con 0.001527 0.002244 to 0.0008095 <0.0001 15 3 15 3 100 Glu Cx36-GCaMP vs EGFP 0.001337 0.002054 to 0.0006195 <0.0001 15 3 15 3 100 Glu Cx36, NR1 vs EGFP 0.0007433 0.001461 to 2.617e-005 0.0365 15 3 15 3 100 Glu Cx36, NR1, NR2A vs EGFP 0.001443 0.002161 to 0.0007262 <0.0001 15 3 15 3 100 Glu Cx36-GCaMP vs Cx36, NR1 0.0005933 –0.0001238 to 0.001311 0.1837 15 3 15 3 100 Glu Cx36-GCaMP vs Cx36, NR1, NR2A –0.0001067 –0.0008238 to 0.0006105 0.9998 15 3 15 3 100 Glu Cx36, NR1 vs Cx36, NR1, NR2A –0.0007000 –0.001417 to 1.717e-005 0.0610 15 3 15 3 Figure 7 One-way ANOVA Tukey Glu vs Con 0.001032 0.001242 to 0.0008212 <0.0001 42 6 37 6 Glu+ACET vs Con –3.643e-006 0.0002442 to –0.0002515 >0.9999 23 3 37 6 Glu+CNQX vs Con 0.0002729 0.0005364 to 9.411e-006 0.0377 19 3 37 6 Glu+GYKI vs Con 0.0002369 0.0005227 to –4.882e-005 0.1651 15 3 37 6 Glu+CPP vs Con –6.046e-006 0.0002574 to –0.0002695 >0.9999 19 3 37 6 Glu+ACET vs Glu –0.001035 –0.0007932 to –0.001278 <0.0001 23 3 42 6 Glu+CNQX vs Glu –0.0007588 –0.0005007 to –0.001017 <0.0001 19 3 42 6 Glu+GYKI vs Glu –0.0007948 –0.0005139 to –0.001076 <0.0001 15 3 42 6 Glu+CPP vs Glu –0.001038 –0.0007796 to –0.001296 <0.0001 19 3 42 6 Figure 8 Two-way ANOVA Tukey EGFP Rp vs Con –5.000e-005 0.0003220 to –0.0004220 0.9960 18 3 18 3 EGFP Rp+KN93 vs Con –1.944e-005 0.0003526 to –0.0003914 >0.9999 18 3 18 3 EGFP Glu vs Con 5.408e-005 0.0004315 to –0.0003233 0.9948 17 3 18 3 EGFP Glu+KN93 vs Con 7.173e-005 0.0004492 to –0.0003057 0.9848 17 3 18 3 Cx36-GCaMP Rp vs Con 0.001030 0.001390 to 0.0006693 <0.0001 22 3 17 3 Cx36-GCaMP Rp+KN93 vs Con 0.001068 0.001441 to 0.0006954 <0.0001 19 3 17 3 Cx36-GCaMP Glu vs Con 0.001686 0.002054 to 0.001317 <0.0001 20 3 17 3 Cx36-GCaMP Glu+KN93 vs Con 0.0004001 0.0007605 to 3.976e-005 0.0213 22 3 17 3 Cx36-GCaMP Rp+KN93 vs Rp 3.828e-005 0.0003878 to –0.0003112 0.9982 19 3 22 3 Cx36-GCaMP Glu+KN93 vs Glu –0.001285 –0.0009407 to –0.001630 <0.0001 22 3 20 3 Glutamate receptor genes Gene Raw count Normalized read count Grik1-As2 GRIK1 antisense RNA 2 1 0.033173785 Grin1 Glutamate ionotropic receptor NMDA type subunit 1 1.531111111 0.050792751 Grin2c Glutamate ionotropic receptor NMDA type subunit 2C 1 0.033173785 Grin3b Glutamate ionotropic receptor NMDA type subunit 3B 1.363636364 0.04523698 Grm1 Glutamate metabotropic receptor 1 0 0 Grm2 Glutamate metabotropic receptor 2 0 0 Grm3 Glutamate metabotropic receptor 3 0 0 Grm4 Glutamate metabotropic receptor 4 0 0 Grm5 Glutamate metabotropic receptor 5 0 0 Grm5-As1 GRM5 antisense RNA 1 0 0 Grm6 Glutamate metabotropic receptor 6 0 0 Grm7 glutamate metabotropic receptor 7 0 0 Grm7-As1 GRM7 antisense RNA 1 0 0 Grm7-As2 GRM7 antisense RNA 2 0 0 Grm7-As3 GRM7 antisense RNA 3 0 0 Grm8 Glutamate metabotropic receptor 8 0 0 Grik1 Glutamate ionotropic receptor kainate type subunit 1 0 0 Grik1-As1 GRIK1 antisense RNA 1 0 0 Grik2 Glutamate ionotropic receptor kainate type subunit 2 0 0 Grik3 Glutamate ionotropic receptor kainate type subunit 3 0 0 Grik4 Glutamate ionotropic receptor kainate type subunit 4 0 0 Grik5 Glutamate ionotropic receptor kainate type subunit 5 0 0 Gria1 Glutamate ionotropic receptor AMPA type subunit 1 0 0 Gria2 Glutamate ionotropic receptor AMPA type subunit 2 0 0 Gria3 Glutamate ionotropic receptor AMPA type subunit 3 0 0 Gria4 Glutamate ionotropic receptor AMPA type subunit 4 0 0 Grid1 Glutamate ionotropic receptor delta type subunit 1 0 0 Grid1-As1 GRID1 antisense RNA 1 0 0 Grid2 Glutamate ionotropic receptor delta type subunit 2 0 0 Grin2a Glutamate ionotropic receptor NMDA type subunit 2A 0 0 Grin2b Glutamate ionotropic receptor NMDA type subunit 2B 0 0 Grin2d Glutamate ionotropic receptor NMDA type subunit 2D 0 0 Grin3a Glutamate ionotropic receptor NMDA type subunit 3A 0 0 Connexin genes Gene Raw count Normalized read count GJA1 Gap junction protein alpha 1 (Cx43) 14.45 0.479361193 GJA9-MYCBP GJA9 (Cx59)-MYCBP readthrough transcript 16.58024691 0.550029546 GJB3 Gap junction protein beta 3 (Cx31) 1.123076923 0.037256712 GJC1 Gap junction protein gamma 1 (Cx45) 5.186435986 0.172053712 GJC2 Gap junction protein gamma 2 (Cx47) 2.0465 0.067890151 GJD3 Gap junction protein delta 3 (Cx31.9) 2.713594595 0.090020204 GJA3 Gap junction protein alpha 3 (Cx46) 0 0 GJA4 Gap junction protein alpha 4 (Cx37) 0 0 GJA5 Gap junction protein alpha 5 (Cx40) 0 0 GJA8 Gap junction protein alpha 8 (Cx50) 0 0 GJA10 Gap junction protein alpha 10 (Cx62) 0 0 GJB1 Gap junction protein beta 1 (Cx32) 0 0 GJB2 Gap junction protein beta 2 (Cx26) 0 0 GJB4 Gap junction protein beta 4 (Cx30.3) 0 0 GJB5 Gap junction protein beta 5 (Cx31.1) 0 0 GJB6 Gap junction protein beta 6 (Cx30) 0 0 GJB7 Gap junction protein beta 7 (Cx25) 0 0 GJC3 Gap junction protein gamma 3 (Cx29) 0 0 GJD2 Gap junction protein delta 2 (Cx36) 0 0 GJD4 Gap junction protein delta 4 (Cx40.1) 0 0
In this issue
