Article Figures & Data
Figures
- Figure 1.
Nasal inflammation and loss of OSNs. A–C, Immunofluorescence for F4/80 (green), IL-1β (red), and nuclei (DAPI, blue) in the ipsilateral OE in saline:10w (A), LPS:10w (B) and NC:10w (C). F4/80-immunopositive macrophages infiltrated the OE in LPS:10w (B) but not in saline:10w (A) or NC:10w (C). Some F4/80-immunopositive macrophages in the OE expressed IL-1β in LPS:10w (B). D–F, Immunofluorescence for Ly-6G (green), IL-1β (red), and nuclei (DAPI, blue) in the ipsilateral OE in saline:10w (D), LPS:10w (E), and NC:10w (F). Ly-6G-immunopositive neutrophils infiltrated the OE in LPS:10w (E) but not in saline:10w (D) or NC:10w (F). A few Ly-6G-immuopositive neutrophils in the OE expressed IL-1β in LPS:10w (E). G–I, Coronal sections of OE stained for OMP (green), GAP43 (red), and nuclei (DAPI; blue) in saline:10w (G), LPS:10w (H), and NC:10w (I). OMP- and GAP43-immunopositive mature and immature OSNs were lost in the ipsilateral OE in LPS:10w (H) but not in saline:10w (G) or NC:10w (I). J–L, Magnified views of ipsilateral OE stained for OMP (green), GAP43 (red), and nuclei (DAPI, blue). Scale bars: 50 μm (A–F, J–L) and 500 μm (G–I).
- Figure 2.
Atrophy of the OB. A–C, Dorsal views of the OBs of saline:10w (A), LPS:10w (B), and NC:10w (C). Ipsilateral OBs atrophied in LPS:10w (B) and NC:10w (C). Scale bars: 1 mm. D, Graph presents the time course of changes in the OB size. Ratios of ipsilateral OB areas to the contralateral ones gradually decreased in LPS:10w and NC:10w; *p < 0.05, **p < 0.01 versus saline:10w.
- Figure 3.
Shrinkage of layers in the OB. A–C, Coronal sections of the ipsilateral OBs stained with DAPI. D, Schematic image of the OB representing each layer. E, Graphs present the ratios of the ipsilateral layer areas to the contralateral ones. Whole OB contains all layers. ONL, GL, and EPL shrank in the LPS:10w, whereas GL, EPL, MCL+IPL, and GCL shrank in the NC:10w; *p < 0.05, **p < 0.01. Scale bars: 500 μm (A–D).
- Figure 4.
OMP and TH expression in the OB. A–F, Immunohistochemistry for OMP, representing ONL and GL, in ipsilateral OBs from saline:10w (A, D), LPS:10w (B, E), and NC:10w (C, F). OMP-immunopositive axon terminals of OSNs were lost particularly in the lateral side of the ipsilateral OB in LPS:10w (B, E) but not in saline:10w (A, D) or NC:10w (C, F). D–F, Magnified views of lateral side of the OBs in A–C. G–I, Immunohistochemistry for TH expressed by some juxtaglomerular cells. TH expression decreased in LPS:10w (H) and in NC:10w (I) compared with that in the saline:10w (G). Nuclei were stained with nuclear fast red. Scale bars: 500 μm (A–C) and 200 μm (D–I).
- Figure 5.
Shrinkage of sEPL. A–F, Coronal sections of the ipsilateral OB stained for calretinin (expressed by mitral cells and some granule cells connecting to mitral cells in the dEPL). Solid yellow lines represent the borders of the GL and EPL or EPL and MCL. Dotted yellow lines represent the borders of sEPL and dEPL. D–F, Magnified views of areas indicated by rectangles in A–C. The sEPL preferentially shrank in LPS:10w and NC:10w. G, Graph presents the ratios of sEPL to total EPL. The ratios of sEPL to total EPL decreased in ipsilateral EPLs in LPS:10w and NC:10w; **p < 0.01. Scale bars: 500 μm (A–C) and 200 μm (D–F).
- Figure 6.
Microglial activation in the OB. A–F, Immunohistochemistry for Iba-1 in ipsilateral OBs. Microglia were activated in LPS:10w (B, E) but not in NC:10w (C, F) compared with those in the saline:10w (A, D). Representative microglia are magnified in D–F. Nuclei were stained for nuclear fast red. Scale bars: 200 μm (A–C) and 20 μm (D–F). G, Graph presents the relative amounts of transcript for Iba-1 in ipsilateral OBs. The Iba-1 transcript amount in the LPS:10w was ∼2.5 times than in the saline:10w; *p < 0.05.
- Figure 7.
Astrocytic hypertrophy and neuroinflammation in the OB. A–F, Immunohistochemistry for GFAP in ipsilateral OBs. Astrocytes were hypertrophic in LPS:10w (B, E) but not prominently in NC:10w (C, F) compared with those in the saline:10w (A, D). Representative astrocytes are magnified in D–F. Nuclei were stained for nuclear fast red. Scale bars: 200 μm (A–C) and 20 μm (D–F). G–J, Graphs present the relative amounts of transcript for GFAP, IL-1β, TNFα, and IL-10 in ipsilateral OBs. The transcript amounts of these molecules were significantly higher in the LPS:10w than in the saline:10w. The transcript amount of IL-10 was also higher in NC:10w than in saline:10w; *p < 0.05, **p < 0.01.
- Figure 8.
Remission of nasal-inflammation and neuro-inflammation. A–C, Coronal sections of the OE stained for OMP (green), GAP43 (red), and nuclei (DAPI, blue). OMP- and GAP43-immunopositive mature and immature OSNs are lost in LPS:10w (A) and regenerated in a patchy manner in the presence (B) and absence (C) of odor input. D, Graph presents the OMP-immunopositive length relative to the total length of ipsilateral OE. The ratio for the OMP-immunopositive length increased in the presence (LPS:10w+NT:10w) or absence (LPS:10w+NC:10w) of odor input; **p < 0.01. E–G, Immunohistochemistry for Iba-1 in the ipsilateral OB. Microglia were activated in LPS:10w (E) but returned to normal in LPS:10w+NT:10w (F) and in LPS:10w+NC:10w (G). Nuclei were stained with nuclear fast red. Scale bars: 500 μm (A–C) and 200 μm (E–G). In the OEs of NC:3w and NC:10w, there are more calretinin-immunopositive OSNs on the closed side than on the open side. Similarly, there are more calretinin-immunopositive OSNs in the OE of LPS:10w+NC:10w than in LPS:10w+NT:10w (Extended Data Fig. 8-1).
- Figure 9.
Recovery of OB in the presence or absence of odor input. A–C, Dorsal views of the OBs from LPS:10w (A), LPS:10w+NT:10w (B), and LPS:10w+NC:10w (C). Ipsilateral OB recovered from atrophy in the presence (B) but not in the absence (C) of odor input. Scale bars: 1 mm. D, Graph presents the ratios of the ipsilateral OB areas to the contralateral ones. The ratio significantly increased in the presence (LPS:10w+NT:10w) but not in the absence (LPS:10w+NC:10w) of odor input; *p < 0.05, **p < 0.01. E, Graph presents the time course of the ratio of the ipsilateral OB area to the contralateral one after 10 weeks of LPS administration.
- Figure 10.
Recovery of each layer in the presence or absence of odor input. A–C, Coronal sections of the OBs stained with DAPI from LPS:10w (A), LPS:10w+NT:10w (B), and LPS:10w+NC:10w (C). Ipsilateral OBs recovered from atrophy in the presence (B) but not in the absence (C) of odor input. Ipsilateral OBs further shrank in the absence of odor input (C). Scale bars: 500 μm. D, Graphs present the ratios of the ipsilateral layer areas to the contralateral ones. ONL areas did not change among LPS:10w, LPS:10w+NT:10w, and LPS:10w+NC:10w, while GL and EPL, which shrank in LPS:10w, recovered in the presence (LPS:10w+NT:10w) but not in the absence (LPS:10w+NC:10w) of odor input. EPL area further shrank in the absence of odor input (LPS:10w+NC:10w). MCL+IPL and GCL, which did not shrink in LPS:10w, shrank in the absence (LPS:10w+NC:10w) but not in the presence (LPS:10w+NT:10w) of odor input; *p < 0.05, **p < 0.01.
- Figure 11.
Recovery of OMP and TH expression in the OB. A–C, Immunohistochemistry for OMP in ipsilateral OB from LPS:10w (A), LPS:10w+NT:10w (B), and LPS:10w+NC:10w (C). OMP expression recovered in LPS:10w+NT:10w (B) and LPS:10w+NC:10w (C) compared with that in the LPS:10w (A). D–F, Immunohistochemistry for TH expressed by some juxtaglomerular cells. TH expression recovered in LPS:10w+NT:10w (E) but further decreased in LPS:10w+NC:10w (F) compared with that in the LPS:10w (D). Nuclei were stained with nuclear fast red. Scale bars: 200 μm.
- Figure 12.
Recovery of sEPL in the presence or absence of odor input. A–F, Coronal sections of ipsilateral OBs stained for calretinin. Solid yellow lines represent the borders of GL and EPL or EPL and MCL. Dotted yellow lines represent the borders of sEPL and dEPL. D–F, Magnified views of EPL indicated by rectangles in A–C. The sEPL area shrank in LPS:10w (A) and recovered in the presence (B) but not in the absence (C) of odor input. Scale bars: 500 μm (A–C) and 200 μm (D–F). G, Graph presents the ratios of sEPL to total EPL. The ratios of sEPL to total EPL significantly decreased in ipsilateral EPL in LPS:10w and LPS:10w+NC:10w, but not in the LPS:10w+NT:10w; **p < 0.01.
Tables
- Table 1
List of antibodies. Information of all antibodies used in this study is listed, including the name, host, dilution, source, and immunogen
Antibodyagainst Host Dilution Source Immunogen F4/80 Rat 1:200 Abcam Thioglycollate-stimulated peritoneal macrophages from C57/BL mice, clone A3-1 Ly-6G Rat 1:200 AdipoGen Purified mouse BALB/c neutrophils, clone Nimp-R14 IL-1β Goat 1:200 R&D Systems E. coli-derived recombinant mouse IL-1β/IL-1F2 Val118-Ser269 OMP Goat 1:1000 Fujifilm Wako PureChemical Corp. Rodent OMP GAP43 Rabbit 1:1000 Novus Biologicals C-terminal peptide of rat and mouse GAP43 with an N-terminalCys added to allow chemical coupling to KLH carrier protein Calretinin Rabbit 1:500 NeoMarkers Recombinant full-length mouse calretinin protein Iba-1 Rabbit 1:200 Wako A synthetic peptide corresponding to the Iba-1 C-terminal sequence(PTGPPAKKAISELP) GFAP Rabbit 1:1000 Dako Agilent GFAP isolated from cow spinal cord TH Rabbit 1:500 Millipore Denatured TH from rat pheochromocytoma Target Direction Sequence (5′ →3′) Accession no. IL-1β Forward CCTCACAAGCAGAGCACAA NM_008361.4 Reverse CCAGCCCATACTTTAGGAAGAC TNFα Forward CTGAGTTCTGCAAAGGGAGAG NM_001278601.1 Reverse CCTCAGGGAAGAATCTGGAAAG IL-10 Forward TTGAATTCCCTGGGTGAGAAG NM_010548.2 Reverse TCCACTGCCTTGCTCTTATTT Iba-1 Forward GACGTTCAGCTACTCTGACTTT NM_019467.3 Reverse GTTGGCCTCTTGTGTTCTTTG GFAP Forward GGAAGACACTGAAACAGGAGAG NM_010277.3 Reverse AGAGCAGTCACAGGGTAAGA GAPDH Forward TCCTCAGTGTAGCCCAAGA NM_001289726.1 Reverse GGAGAAACCTGCCAAGTATGA Information of all primers used in this study is listed, including the target, direction, sequence, and accession number.
Extended Data Figure 8-1
Increased number of calretinin-positive OSNs in the closed side of NC. A–D, Coronal sections of the OE stained for OMP (green), calretinin (red), and nuclei (DAPI, blue). Calretinin-immunopositive intermediate OSNs increased in the closed side of NC:3w and NC:10w compared with that in the open side. Note that the number of OMP- and calretinin-double immunopositive cells increase in the closed side of NC mice. E–G, Coronal sections of the OE stained for calretinin (red) and nuclei (DAPI, blue). Calretinin-immunopositive OSNs are lost in LPS:10w (E) and regenerated in a patchy manner in the presence (F) and absence (G) of odor input. Note that calretinin-immunopositive OSNs remarkably increased in number in LPS:10w+NC:10w. Download Figure 8-1, TIF file.
In this issue
