Article Figures & Data
Figures
- Figure 1.
AIE exposure increases miR-137 expression in the male adult amygdala. A, Schematic of AIE or adolescent intermittent saline (AIS) exposure followed by behavioral analysis and amygdala tissue collection in adulthood. B, qPCR measurement of miR-137 in the amygdala of AIS and AIE adult rats (n = 5–6, *p < 0.05 by Student’s t test). C, Schematic of miR-137 targeting of Lsd1 and the neuron-specific splice variant Lsd1 + 8a mRNA. D, GO analysis performed with Enrichr for enrichment of GO Biological Process terms using a list of bioinformatically-predicted miR-137 target genes (Extended Data Fig. 1-1). The top ten enriched GO terms are expressed as a log10(1/p value). E, qPCR measurement of Lsd1 and Lsd1 + 8a mRNA in the amygdala of AIS and AIE adult rats (n = 5–6, *p < 0.05, ***p < 0.001 by Student’s t test). F, ChIP analysis of LSD1 occupancy of the Bdnf exon IV promoter region in the amygdala of AIS and AIE adult rats (n = 5, ***p < 0.001 by Student’s t test). Data expressed as mean ± SEM.
- Figure 2.
miR-137 antagomir infusion directly into the CeA reverses AIE-induced anxiety-like behaviors and target mRNA expression. A, Schematic of AIE or adolescent intermittent saline (AIS) exposure followed by cannulation surgery and infusion of an antagomir specific to miR-137, scrambled antagomir, or vehicle directly into the CeA of adult male rats. B, Bar diagram showing anxiety-like behaviors (measured in the EPM test) in AIS and AIE adult rats infused with miR-137 antagomir, scrambled antagomir, or vehicle (iFect solution) directly into the CeA (n = 6–7, ***p < 0.001 vs AIS+ vehicle, ###p < 0.001 vs AIE+ vehicle, $$$p < 0.001 vs AIE+ scrambled by one-way ANOVA followed by Tukey’s post hoc test). C, qPCR analysis of the miR-137 target genes Lsd1 and Lsd1 + 8a mRNA in the amygdala of AIS and AIE adult rats infused with miR-137 antagomir, scrambled antagomir, or vehicle directly into the CeA (n = 6–7, *p < 0.05 vs AIS+ vehicle, **p < 0.01 vs AIS+ vehicle, ##p < 0.01 vs AIE+ vehicle, $p < 0.05 vs AIE+ scrambled by one-way ANOVA followed by Tukey’s post hoc test). D, ChIP analysis of LSD1 occupancy of the Bdnf exon IV promoter region in the amygdala of AIS and AIE adult rats infused with miR-137 antagomir, scrambled antagomir, or vehicle into the CeA (n = 6–7, *p < 0.05, **p < 0.01 vs AIS+ vehicle by one-way ANOVA followed by Tukey’s post hoc test). E, ChIP analysis of H3K9me2 and H3K4me2 occupancy of the Bdnf exon IV promoter region in the amygdala of AIS and AIE adult rats infused with miR-137 antagomir, scrambled antagomir, or vehicle into the CeA (n = 6–7, *p < 0.05 vs AIS+ vehicle, ##p < 0.01 vs AIE+ vehicle, $p < 0.05 vs AIE+ scrambled by one-way ANOVA followed by Tukey’s post hoc test). F, qPCR analysis of Bdnf exon IV (Bdnf IV) mRNA in the amygdala of AIS- and AIE-exposed adult rats infused with miR-137 antagomir, scrambled antagomir, or vehicle (iFect solution) into the CeA (n = 6–7, *p < 0.05 vs AIS+ vehicle by one-way ANOVA followed by Tukey’s post hoc test). Data expressed as mean ± SEM.
- Figure 3.
Lsd1 siRNA infusion into the CeA prevents reversal of AIE-induced behavioral and epigenetic changes by miR-137 antagomir. A, Schematic of AIE or adolescent intermittent saline (AIS) exposure followed by cannulation surgery and infusion of miR-137 antagomir or scrambled antagomir along with Lsd1 siRNA or control siRNA into the CeA during adulthood. B, Anxiety-like behavioral analysis in the EPM test in AIS and AIE adult rats infused with miR-137 antagomir or scrambled antagomir along with Lsd1 siRNA or control siRNA directly into the CeA (n = 6–7, *p < 0.05, ***p < 0.001 vs AIS+ scrambled antagomir/control siRNA, ##p < 0.01, ###p < 0.001 vs AIE+ scrambled antagomir/control siRNA, $p < 0.05, $$$p < 0.001 vs AIE+ miR-137 antagomir/control siRNA by one-way ANOVA followed by Tukey’s post hoc test). Data expressed as mean ± SEM. C, qPCR analysis of Lsd1 and Lsd1 + 8a mRNA in the amygdala of AIS and AIE rats infused with miR-137 antagomir or scrambled antagomir along with Lsd1 siRNA or scrambled siRNA directly into the CeA (n = 6–7, ***p < 0.001 vs AIS+ scrambled antagomir/control siRNA, ###p < 0.001 vs AIE+ scrambled antagomir/control siRNA, $$$p < 0.001 vs AIE+ miR-137 antagomir/control siRNA by one-way ANOVA followed by Tukey’s post hoc test). Data expressed as mean ± SEM. D, ChIP analysis of LSD1 and H3K9me2 occupancy of the Bdnf exon IV promoter region in the amygdala of AIS and AIE adult rats infused with miR-137 antagomir or scrambled antagomir along with Lsd1 siRNA or control siRNA directly into the CeA (n = 6–7, ***p < 0.001 vs AIS+ scrambled antagomir/control siRNA, ###p < 0.001 vs AIE+ scrambled antagomir/control siRNA, $$$p < 0.001 vs AIE+ miR-137 antagomir/control siRNA by one-way ANOVA followed by Tukey’s post hoc test). Data expressed as mean ± SEM. E, qPCR analysis of Bdnf IV mRNA in the amygdala of AIS and AIE adult rats infused with miR-137 antagomir or scrambled antagomir along with Lsd1 siRNA or control siRNA directly into the CeA (n = 6–7, ***p < 0.001 vs AIS+ scrambled antagomir/control siRNA, ###p < 0.001 vs AIE+ scrambled antagomir/control siRNA, $$$p < 0.001 vs AIE+ miR-137 antagomir/control siRNA by one-way ANOVA followed by Tukey’s post hoc test). Data expressed as mean ± SEM.
- Figure 4.
miR-137 antagomir infusion into the CeA reverses AIE-induced increases in adult alcohol consumption. A, Schematic of AIE or adolescent intermittent saline (AIS) exposure followed by cannulation surgery and infusion of antagomir to miR-137 or vehicle (iFect solution) into the CeA during adulthood. B, Measurement of ethanol consumption (g/kg/d) using two-bottle free choice paradigm. Arrows indicate days of miR-137 antagomir or vehicle infusion (twice per day for 2 d). Data expressed as mean ± SEM (n = 6–11, *p < 0.05, **p < 0.01, ***p < 0.001 vs AIS+ vehicle, ##p < 0.01, ###p < 0.001 vs AIE+ vehicle by two-way repeated measures ANOVA followed by Tukey’s post hoc test). C, Measurement of ethanol preference using two-bottle free choice paradigm. Arrows indicate days of miR-137 antagomir or vehicle infusion (twice per day for 2 d). Data expressed as mean ± SEM (n = 6–11, ***p < 0.001 vs AIS+ vehicle, ###p < 0.001 vs AIE+ vehicle by two-way repeated measures ANOVA followed by Tukey’s post hoc test). D, Total volume consumed (ml) in AIS and AIE rats exposed to either miR-137 antagomir or vehicle in a two-bottle free choice ethanol consumption task. Data are expressed as mean ± SEM (n = 6–11, *p < 0.05, **p < 0.01, ***p < 0.001 vs AIS+ vehicle by two-way repeated measures ANOVA followed by Tukey’s post hoc test). Arrows indicate days of miR-137 antagomir or vehicle infusion (twice per day for 2 d).
- Figure 5.
Effect of acute ethanol challenge in adulthood on AIE-induced increases in miR-137 levels in the amygdala of rats. A, Schematic of AIE or adolescent intermittent saline (AIS) exposure followed by an acute challenge of ethanol (2 g/kg, i.p.) or volume-matched saline and sacrificed 1 h later. B, qPCR measurement of miR-137 in the amygdala of AIS and AIE adult rats exposed to an acute challenge of ethanol or volume-matched saline. Data expressed as mean ± SEM (n = 6, *p < 0.05 by two-way ANOVA followed by Tukey’s post hoc test).
- Figure 6.
Conceptual model of the molecular and behavioral effects of AIE on miR-137 and LSD1-mediated chromatin remodeling in the adult amygdala. Adolescent intermittent exposure (AIE) leads to increased expression of miR-137, thereby decreasing expression of LSD1 and its neuron specific variant (LSD1 + 8a) in the adult rat amygdala. Increased expression of miR-137 is associated with decreased levels of LSD1 and increased levels of H3K9me2 at the Bdnf exon IV promoter, leading to decreased Bdnf IV mRNA expression and BDNF protein levels (Pandey et al., 2015). Blockade of the upregulation of miR-137 via antagomir in the CeA rescues these epigenetic modifications and deficits in Bdnf expression. miR-137 antagomir infusion in the CeA also attenuate the phenotypes of heightened anxiety and higher alcohol intake induced by AIE in adult rats. Concomitant inhibition of Lsd1 by siRNA in the CeA blocks the miR-137 antagomir-mediated rescue of AIE-induced behavioral phenotypes and altered chromatin at the Bdnf exon IV promoter. These results identify miR-137 as an important epigenetic regulator in the CeA that mechanistically regulates AIE-induced anxiety-like and alcohol-drinking behaviors.
Tables
- Table 1.
Primers sets used for miRNA analysis (using TaqMan probe assays), qPCR analysis of mRNA transcripts, and ChIP assay using qPCR
Primer name Sequence TaqMan miRNA primers miR-137-3p UUAUUGCUUAAGAAUACGCGUAG U6 AGAAGATTAGCATGGCCCCT mRNA primers Lsd1 forward CGCCACGGTCTTATCAACTT Lsd1 reverse GCCAGAAACACCTGAGCCTA Lsd1 + 8a forward GAGGAAATCCCATGGCTGT Lsd1 + 8a reverse GGAACCTTGACAGTGTCAGCTT Bdnf IV mRNA forward TCTCACTGAAGGCGTGCGAGTATT Bdnf IV mRNA reverse TGGTGGCCGATATGTACTCCTGTT Hprt1 forward TCCTCAGACCGCTTTTCCCGC Hprt1 reverse TCATCATCACTAATCACGACGCTGG ChIP qPCR primers Bdnf IV promoter forward GTTCGCTAGGACTGGAAGTGG Bdnf IV promoter reverse CCTCTGCCTCGAAATAGACAC
Extended Data Figure 1-1
Bioinformatic analysis of miR-137 target genes. miRNA target predictions for miR-137 in the rat were obtained from TargetScan (www.targetscan.org). The resulting gene target list was then analyzed using Enrichr (https://amp.pharm.mssm.edu/Enrichr/) specifically for Biological Process GO terms. The top ten GO Biological Process terms are shown here and sorted by the combined score as calculated in Enrichr, which is obtained by multiplying the log-transformed p value and z score. KDM1A, also known as LSD1, was used for validation in our functional study of inhibition of miR-137 by antagomir infusion into CeA. Download Figure 1-1, DOCX file.
In this issue
