Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT

User menu

Search

  • Advanced search
eNeuro
eNeuro

Advanced Search

 

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT
PreviousNext
Research ArticleNew Research, Disorders of the Nervous System

In Vitro Modeling of the Bipolar Disorder and Schizophrenia Using Patient-Derived Induced Pluripotent Stem Cells with Copy Number Variations of PCDH15 and RELN

Takaya Ishii, Mitsuru Ishikawa, Koki Fujimori, Takuji Maeda, Itaru Kushima, Yuko Arioka, Daisuke Mori, Yuhki Nakatake, Bun Yamagata, Shintaro Nio, Takahiro A. Kato, Nan Yang, Marius Wernig, Shigenobu Kanba, Masaru Mimura, Norio Ozaki and Hideyuki Okano
eNeuro 20 September 2019, 6 (5) ENEURO.0403-18.2019; https://doi.org/10.1523/ENEURO.0403-18.2019
Takaya Ishii
1Department of Physiology, Keio University School of Medicine, Shinjuku-ku, Tokyo 160-8582, Japan
2iPS Cell-Based Drug Discovery, Drug Research Division, Sumitomo Dainippon Pharma. Co., Ltd, Osaka, Osaka 554-0022, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Takaya Ishii
Mitsuru Ishikawa
1Department of Physiology, Keio University School of Medicine, Shinjuku-ku, Tokyo 160-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Koki Fujimori
1Department of Physiology, Keio University School of Medicine, Shinjuku-ku, Tokyo 160-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Takuji Maeda
1Department of Physiology, Keio University School of Medicine, Shinjuku-ku, Tokyo 160-8582, Japan
3Department of Psychiatry, Nagoya University Graduate School of Medicine, Aichi, Nagoya 466-8550, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Itaru Kushima
3Department of Psychiatry, Nagoya University Graduate School of Medicine, Aichi, Nagoya 466-8550, Japan
4Institute for Advanced Research, Nagoya University, Aichi, Nagoya 466-8550, Japan
5Medical Genomics Center, Nagoya University Hospital, Aichi, Nagoya 466-8550, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yuko Arioka
3Department of Psychiatry, Nagoya University Graduate School of Medicine, Aichi, Nagoya 466-8550, Japan
4Institute for Advanced Research, Nagoya University, Aichi, Nagoya 466-8550, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Daisuke Mori
3Department of Psychiatry, Nagoya University Graduate School of Medicine, Aichi, Nagoya 466-8550, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Daisuke Mori
Yuhki Nakatake
6Department of Systems Medicine, Keio University School of Medicine, Shinjuku-ku, Tokyo 160-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Bun Yamagata
7Department of Neuropsychiatry, Keio University School of Medicine, Shinjuku-ku, Tokyo 160-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Shintaro Nio
7Department of Neuropsychiatry, Keio University School of Medicine, Shinjuku-ku, Tokyo 160-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Takahiro A. Kato
8Department of Neuropsychiatry, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Takahiro A. Kato
Nan Yang
9Institute for Stem Cell Biology and Regenerative Medicine and Department of Pathology, Stanford University School of Medicine, Stanford, California 94305
10Department of Neuroscience, Friedman Brian Institute, Black Family Stem Cell Institute, Icahn School of Medicine at Mount Sinai, New York 10029
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Marius Wernig
9Institute for Stem Cell Biology and Regenerative Medicine and Department of Pathology, Stanford University School of Medicine, Stanford, California 94305
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Shigenobu Kanba
8Department of Neuropsychiatry, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Masaru Mimura
7Department of Neuropsychiatry, Keio University School of Medicine, Shinjuku-ku, Tokyo 160-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Masaru Mimura
Norio Ozaki
3Department of Psychiatry, Nagoya University Graduate School of Medicine, Aichi, Nagoya 466-8550, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Norio Ozaki
Hideyuki Okano
1Department of Physiology, Keio University School of Medicine, Shinjuku-ku, Tokyo 160-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Hideyuki Okano
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Figure1
    • Download figure
    • Open in new tab
    • Download powerpoint
  • Figure 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1.

    Generation and characterization of iPSCs derived from a BP patient. A, Schematic diagram of the strategy to explore the phenotypes of BP and SCZ in vitro. B, Subjects list containing basic information. C, CNVs in chromosome 10 were detected in blood and iPSCs derived from two BP patients by aCGH. D, The exonic deletions of PCDH15 identified in this study were validated by the TaqMan copy number assays. Bars indicate copy numbers predicted by the TaqMan copy number assays. Capped bars indicated the minimum and maximum copy number calculated for the sample replicate group (n = 4). Controls carried no aCGH-detected CNVs of PCDH15 (copy number = 2) and were used to calibrate the assays. E, The generated iPSCs expressed the pluripotent markers Oct4, Nanog, SSEA4, and Tra1-60. Scale bar, 100 μm. F, Representative images of immunocytochemical analysis for in vitro three-germ layer differentiation. βIII-Tubulin, αSMA, and AFP are pluripotent markers of the ectoderm, mesoderm, and endoderm, respectively. Blue indicates Ho, and green indicates the pluripotent marker. Scale bar, 100 μm.

  • Figure 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2.

    Neuron differentiation via EB formation. A, Overview of the protocol for EB formation. DSi represents SB431542 and LDN193189. B, Representative images of EBs on day 7. Scale bar, 200 μm. C, Quantification of EB sizes (n = 3 independent experiments; mean ± SD; Dunnett’s test, no significant differences were observed). D, The form factor of the EBs was calculated as an indicator of roundness. E, Gene expression of iPSCs and DSi-EBs. E, Relative gene expression levels of PCDH15 and RELN in DSi-EBs derived from six control lines, two BP lines (BP1-1 and BP1-2), and two SCZ lines (SCZ1-1 and SCZ1-2; n = 3 independent experiments; mean ± SD; Dunnett’s test). Values were normalized to that of the control, which was considered to be 1.0. One sample of 1210B2-derived DSi-EBs, in which PCDH15 expression was under the detection limit, was removed from the analysis. F, Overview of the protocol for neuron differentiation via EB formation. DSi represents SB431542 and LDN193189. G, Intensity levels of three germ layer markers, namely, βIII-tubulin, αSMA, and AFP. Intensity levels were normalized to that of the control, which was considered to be 1.0 (n = 3 independent experiments; mean ± SD; Dunnett’s test among each group, no significant differences were observed). H, Schematic diagram of the analysis protocol. Fiber length and number of βIII tubulin+ cells were quantified from binarized image data obtained from stained images. I, Representative images of βIII-tubulin+ neurons. Scale bar, 300 μm. J, Time-dependent changes of βIII-tubulin+ mean neurite length per neurite fiber (n = 3 independent experiments; mean ± SD; *p < 0.05, **p < 0.01; Dunnett’s test among each group). Mean neurite length is shown as the mean length of βIII-tubulin+ neurite fiber.

  • Figure 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3.

    Neuron differentiation by transcription factor overexpression. A, Overview of the protocol for differentiation into glutamatergic neurons. B, Immunocytochemical analysis of neuronal markers (VGluT2, MAP2, and βIII tubulin). Scale bar, 40 μm. C, Ratio of positive cells for each marker; βIII tubulin+ cells/all cells (βIII tubulin+/Ho+), MAP2+ cells/βIII tubulin+ cells (MAP2+/ βIII-tubulin+), and VGluT2 and βIII tubulin double+ cells/βIII tubulin+ cells (VGLUT2+βIII tubulin+/βIII tubulin+). (n = 3-6 independent experiments; mean ± SD; *p < 0.05; Tukey’s test, the population of βIII tubulin+ cells in BP2-1-derived neurons was significantly lower than those in 1210B2-, 201B7-, BP1-1-, and BP1-2-derived neurons). D, Relative gene expression levels of PCDH15 (primer set1) and RELN in NEUROG2-transduced iPSCs and induced neurons (n = 3 independent experiments; mean ± SD; Dunnett’s test among iPSCs and among neurons, no significant differences were observed). Values were normalized to that for 1210B2-derived neurons, which was considered to be 1.0. Some iPSC samples, in which PCDH15 expression was under the detection limit, were removed from the analysis. Specifically, two samples of BP1-1, and one sample of 1210B2, 201B7, BP2-1, and SCZ1-1 were excluded from the analysis. E, Overview of the protocol for differentiation into GABAergic neurons. F, Immunocytochemical analysis of neuronal markers (MAP2, GABA, and βIII tubulin). Scale bar, 40 μm. G, Ratio of positive cells for each marker; βIII tubulin+ cells/all cells (βIII tubulin+/Ho+), MAP2+ cells/βIII tubulin+ cells (MAP2+/βIII tubulin+), and GABA and βIII-tubulin double-positive cells/βIII tubulin+ cells (GABA+βIII tubulin+/βIII tubulin+). (n = 3-6 independent experiments; mean ± SD; Tukey’s test; no significant differences were observed). H, Relative gene expression levels of PCDH15 and RELN in ASCL1- and DLX2-transduced iPSCs and induced neurons. (n = 3 independent experiments; mean ± SD; Dunnett’s test among iPSCs and among neurons; no significant differences were observed). Values were normalized to that for 1210B2-derived neurons, which was considered to be 1.0. Some iPSC samples, in which PCDH15 expression was under the detection limit, were removed from the analysis. Specifically, each one sample of 1210B2 and BP2-1 was excluded from the analysis.

  • Figure 4.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 4.

    Comparison of the global gene expression profiles. A, PCA of the gene expression data of glutamatergic neurons. B, Hierarchical clustering analysis of DEGs in glutamatergic neurons. C, Venn diagram of DEGs of BP or SCZ glutamatergic neurons compared with control neurons (fold change, >2.0). A total of 498 genes were common between the two groups compared. D, Featured GO and pathway terms for the 498 common DEGs among the control vs BP and control vs SCZ. Adhesion- and neuron-associated terms were extracted. E, PCA plot of the gene expression data of GABAergic neurons. Green, control (1210B2, 201B7); blue, BP; red, SCZ. F, Hierarchical clustering analysis of DEGs in GABAergic neurons. G, Venn diagram of DEGs of BP or SCZ GABAergic neurons in comparison with control neurons (fold change, >2.0). A total of 522 genes were common among the two comparisons. H, Featured GO and pathway terms for 522 common DEGs among the control vs BP and control vs SCZ. Adhesion- and neuron-associated terms were extracted.

  • Figure 5.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 5.

    Neurons induced from patient-derived iPSCs exhibit abnormal phenotypes of dendrite length and synapse formation. A, Schematic diagram of the protocol for phenotypic analysis of dendrite lengths and number of synaptic markers of the neurons. B, C, Representative images of immunocytochemical analysis of a dendrite marker (MAP2; scale bar, 60 μm; B) and synaptic markers (Homer I, Synapsin I; scale bar, 10 μm; C) in glutamatergic neurons. D, Quantitative analysis of dendrite length in glutamatergic neurons (n = 3-6 independent experiments; mean ± SD; **p < 0.01; Dunnett’s test). E, Quantitative analysis of the number of synaptic marker puncta in glutamatergic neurons (n = 3-6 independent experiments; mean ± SD; *p < 0.05, **p < 0.01; Dunnett’s test). Homer I puncta, Synapsin I puncta and Homer-Synapsin I colocalized puncta on βIII-tubulin+ cells were counted. F, G, Representative images of immunocytochemical analysis of a dendrite marker (MAP2; scale bar, 60 μm; F) and synaptic markers (Gephyrin, Synapsin I; scale bar, 10 μm; G) in GABAergic neurons. H, Quantitative analysis of dendrite length in GABAergic neurons (n = 3-6 independent experiments; mean ± SD; **p < 0.01, Dunnett’s test). I, Quantitative analysis of the number of synaptic marker puncta in glutamatergic neurons (n = 3-6 independent experiments; mean ± SD; *p < 0.05, **p < 0.01, Dunnett’s test). Gephyrin puncta, Synapsin I puncta, and Gephyrin-Synapsin I colocalized puncta on βIII tubulin+ cells were counted.

  • Figure 6.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 6.

    Generation of isogenic PCDH15 deletion iPSCs by targeted genome editing. A, The target sites of CRISPR-sgRNAs in exon 9 of the PCDH15 gene (NM_001142763). Red bars represent PAM (protospacer adjacent motif) sequences. B, Analysis of CRISPR-sgRNA activity by the T7E1 assay using HEK293FT. NTC, No transfection. Among the constructed sgRNAs, sgRNA#3 showed the strongest cleavage activity. C, Indel pattern of the isogenic line using CRISPR-sgRNA#3. Blue letters represent stop codon. D, Representative images of immunocytochemical analysis for in vitro three-germ layer differentiation. Blue indicates Ho and green indicates the pluripotent marker (βIII-tubulin, αSMA, and AFP). Scale bar, 100 μm. E, Relative gene expression levels of PCDH15 (primer set2) in glutamatergic or GABAergic neurons on day 28 (n = 3 independent experiments; mean ± SD; *p < 0.05, Student’s t test). F, Information of isogenic RELN-deleted iPSCs generated in the previous study (Arioka et al., 2018). G, Relative gene expression levels of RELN in induced glutamatergic or GABAergic neurons on day 28 (n = 3 independent experiments; mean ± SD; **p < 0.01, Student’s t test).

  • Figure 7.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 7.

    Isogenic PCDH15 or RELN deleted neurons showed partial phenotypes of dendrite and synapse formation. A, Representative images of immunocytochemical analysis of neuronal markers (scale bar, 40 μm) and synaptic markers (scale bar, 10 μm) in glutamatergic neurons. B, Ratio of positive cells for each marker; βIII tubulin+ cells/all cells (βIII tubulin+), MAP2+ cells/βIII tubulin+ cells (MAP2+), and VGLUT2 and βIII tubulin double-positive cells/βIII tubulin+ cells (VGluT2+βIII tubulin+). (n = 4–6 independent experiments; mean ± SD; **p < 0.01, Student’s t test between each pair of control and isogenic lines). C, Quantitative analysis of dendrite length in glutamatergic neurons (n = 4–6 independent experiments; mean ± SD; *p < 0.05, Student’s t test). D, Quantitative analysis of the number of synaptic marker puncta in glutamatergic neurons (n = 3–6 independent experiments; mean ± SD; *p < 0.05, Student’s t test). E, Representative images of immunocytochemical analysis of neuronal markers (scale bar, 40 μm) and synaptic markers (scale bar, 10 μm) in GABAergic neurons. F, Ratio of positive cells for each marker; βIII tubulin+, MAP2+, and GABA and βIII tubulin double-positive cells/βIII tubulin+ neuronal cells (GABA+βIII tubulin+). (n = 4–6 independent experiments; mean ± SD; *p < 0.05, Student’s t test between Control 1 and PCDH15del or between Control 2 and RELNdel). G, Quantitative analysis of dendrite length in GABAergic neurons (n = 4–6 independent experiments; mean ± SD; **p < 0.01, Student’s t test). H, Quantitative analysis of the number of synaptic marker puncta in GABAergic neurons (n = 4–6 independent experiments; mean ± SD; *p < 0.05, Student’s t test).

  • Figure 8.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 8.

    Spontaneous activity of neurons induced from patient-derived or isogenic iPSCs. A, Overview of the protocol for neuronal differentiation for functional analysis. B, Quantitative analysis of dendrite length and synaptic markers puncta in neurons cultured in BrainPhys for differentiation on day 28 (n = 3–4 independent experiments; mean ± SD; **p < 0.01, Dunnett’s test among control, BP, and SCZ neurons; BP: BP1-2, SCZ: SCZ1-2). C, Overview of MEA plate and representative images of neurons induced from iPSCs on the 48-well MEA plates. Bright-field image and immunocytochemical images of neuron markers. Scale bar, 200 μm. D, Representative image of raster plot and definition of active electrodes. E, Spike frequency of control or patient-derived glutamatergic neurons on day 28 and day 42 (n = 4–6 independent experiments; mean ± SD; Dunnett’s test among Control, BP, and SCZ neurons, no significant differences were observed; paired t test between day 28 and day 42, *p < 0.05). F, Spike frequency of isogenic iPSC-derived glutamatergic neurons (n = 3–4 independent experiments; mean ± SD; Dunnett’s test among Control, BP, and SCZ neurons, no significant differences were observed; paired t test between day 28 and day 42, *p < 0.05). G, Relative change in the total number of spikes after drug treatment in glutamatergic neurons on day 42 (n = 3 independent experiments; mean ± SD; *p < 0.05, **p < 0.01, Dunnett’s test). H, Representative image of calcium spikes and display of parameters (ΔFmax and calcium spike numbers). I, ΔFmax and calcium spike frequency in control or patient-derived GABAergic neurons (n = 3–6 independent experiments; mean ± SD; Dunnett’s test among each line, no significant differences were observed). J, ΔFmax and calcium spike frequency in control or patient-derived GABAergic neurons (n = 4–6 independent experiments; mean ± SD; Student’s t test, no significant differences were observed).

Tables

  • Figures
    • View popup
    Table 1.

    Used primers for generating isogenic PCDH15 deletion iPSCs

    TargetsPrimersSequence (5´ → 3´)
    sgRNAs constructionsgRNA#1-Fw GAGACCACTTGGATCCGGACGGCAATCACGAGTGTTGTTTTAGAGCTAGAAATAGCA
    sgRNA#2-Fw GAGACCACTTGGATCCGTCGCCTCTCATTCAGATTTGTTTTAGAGCTAGAAATAGCA
    sgRNA#3-Fw GAGACCACTTGGATCCGTGGCAGCTTGATAAGTGAGGTTTTAGAGCTAGAAATAGCA
    sgRNA#4-Fw GAGACCACTTGGATCCGCGCCTCTCATTCAGATTTTGTTTTAGAGCTAGAAATAGCA
    sgRNA#5-Fw GAGACCACTTGGATCCGCTCATTCAGATTTTGGGCAGTTTTAGAGCTAGAAATAGCA
    sgRNA#universal-Rv GCCCGGGTTTGAATTCAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAA
    T7E1 assayFw CTCAGTTTACATCCTGACTCAACCAC
    RvCCTTCAAACGGCCAAACATAATCTCC
    • Sequence information of the primers for sgRNAs construction and T7E1 assay. Fw, Forward primer; Rv, reverse primer. Also see Materials and Methods.

    • View popup
    Table 2.

    p Values of the indicated statistical comparisons

    FiguresMeasurementType of testcomparisonp Value
    Figure 2CEB size (EB)Dunnett’s testControl vs BP10.4406
    Control vs SCZ10.5982
    EB size (DSi-EB)Dunnett’s testControl vs BP10.5619
    Control vs SCZ10.9784
    Figure 2DEB form factor (EB)Dunnett’s testControl vs BP10.5015
    Control vs SCZ10.7476
    EB form factor (DSi-EB)Dunnett’s testControl vs BP10.0662
    Control vs SCZ10.0562
    Figure 2EPCDH15 gene expressionDunnett’s testControl vs BP10.3861
    Control vs SCZ10.3897
    Reln gene expressionControl vs BP10.7288
    Control vs SCZ10.5178
    Figure 2GIntensity/area (βIII tubulin)Dunnett’s testControl vs BP10.9826
    Control vs SCZ10.2543
    Intensity/area (αSMA)Dunnett’s testControl vs BP10.9778
    Control vs SCZ10.9238
    Intensity/area (AFP)Dunnett’s testControl vs BP10.7731
    Control vs SCZ10.9345
    Figure 2JNeurite length (day 10)Dunnett’s testControl vs BP10.7746
    Control vs SCZ10.8824
    Neurite length (day13)Dunnett’s testControl vs BP10.0293
    Control vs SCZ10.0324
    Neurite length (day16)Dunnett’s testControl vs BP10.0192
    Control vs SCZ10.01
    Neurite length (day22)Dunnett’s testControl vs BP10.0036
    Control vs SCZ10.0025
    Figure 3CNo. of cells (βIII tubulin+/HO+)Tukey’s test1210B2 vs 201B70.9993
    1210B2 vs BP1-11
    1210B2 vs BP1-21
    1210B2 vs BP2-10.0218
    1210B2 vs SCZ1-10.5216
    1210B2 vs SCZ1-20.875
    201B7 vs BP1-10.9975
    201B7 vs BP1-20.9989
    201B7 vs BP2-10.0036
    201B7 vs SCZ1-10.2079
    201B7 vs SCZ1-20.5352
    BP1-1 vs BP1-21
    BP1-1 vs BP2-10.0077
    BP1-1 vs SCZ1-10.4016
    BP1-1 vs SCZ1-20.8143
    BP1-2 vs BP2-10.0042
    BP1-2 vs SCZ1-10.3116
    BP1-2 vs SCZ1-20.7283
    BP2-1 vs SCZ1-10.5238
    BP2-1 vs SCZ1-20.1306
    SCZ1-1 vs SCZ1-20.9847
    No. of cells (MAP2+/βIII tubulin+)Tukey’s test1210B2 vs 201B71
    1210B2 vs BP1-10.6317
    1210B2 vs BP1-20.9984
    1210B2 vs BP2-10.6973
    1210B2 vs SCZ1-10.9988
    1210B2 vs SCZ1-20.9994
    201B7 vs BP1-10.7153
    201B7 vs BP1-21
    201B7 vs BP2-10.7806
    201B7 vs SCZ1-11
    201B7 vs SCZ1-21
    BP1-1 vs BP1-20.7807
    BP1-1 vs BP2-11
    BP1-1 vs SCZ1-10.8539
    BP1-1 vs SCZ1-20.7703
    BP1-2 vs BP2-10.8448
    BP1-2 vs SCZ1-11
    BP1-2 vs SCZ1-21
    BP2-1 vs SCZ1-10.8955
    BP2-1 vs SCZ1-20.8325
    SCZ1-1 vs SCZ1-21
    No. of cells (VGluT2+βIII tubulin+/βIII tubulin+)Tukey’s test1210B2 vs 201B70.9629
    1210B2 vs BP1-10.2892
    1210B2 vs BP1-20.9885
    1210B2 vs BP2-10.8416
    1210B2 vs SCZ1-10.6553
    1210B2 vs SCZ1-20.9756
    201B7 vs BP1-10.7818
    201B7 vs BP1-20.9999
    201B7 vs BP2-10.9996
    201B7 vs SCZ1-10.9859
    201B7 vs SCZ1-21
    BP1-1 vs BP1-20.5003
    BP1-1 vs BP2-10.9484
    BP1-1 vs SCZ1-10.9956
    BP1-1 vs SCZ1-20.6512
    BP1-2 vs BP2-10.9885
    BP1-2 vs SCZ1-10.9093
    BP1-2 vs SCZ1-21
    BP2-1 vs SCZ1-10.9998
    BP2-1 vs SCZ1-20.9975
    SCZ1-1 vs SCZ1-20.9616
    Figure 3DPCDH15 gene expression (iPS)Dunnett’s testControl vs BP0.9527
    Control vs SCZ0.9354
    PCDH15 gene expression (neuron)Dunnett’s testControl vs BP0.2862
    Control vs SCZ0.4102
    RELN gene expression (iPS)Dunnett’s testControl vs BP0.1826
    Control vs SCZ0.3746
    RELN gene expression (neuron)Dunnett’s testControl vs BP0.6918
    Control vs SCZ0.9941
    Figure 3GNo. of cells (βIII tubulin+/HO+)Tukey’s test1210B2 vs 201B70.98
    1210B2 vs BP1-10.9914
    1210B2 vs BP1-20.9863
    1210B2 vs BP2-10.4556
    1210B2 vs SCZ1-11
    1210B2 vs SCZ1-20.9992
    201B7 vs BP1-10.7241
    201B7 vs BP1-21
    201B7 vs BP2-10.1395
    201B7 vs SCZ1-10.9894
    201B7 vs SCZ1-20.9993
    BP1-1 vs BP1-20.7192
    BP1-1 vs BP2-10.7873
    BP1-1 vs SCZ1-10.9536
    BP1-1 vs SCZ1-20.8677
    BP1-2 vs BP2-10.1102
    BP1-2 vs SCZ1-10.9937
    BP1-2 vs SCZ1-20.9998
    BP2-1 vs SCZ1-10.2366
    BP2-1 vs SCZ1-20.1646
    SCZ1-1 vs SCZ1-20.9999
    No. of cells (MAP2+/βIII tubulin+)Tukey’s test1210B2 vs 201B70.9997
    1210B2 vs BP1-10.9897
    1210B2 vs BP1-20.9829
    1210B2 vs BP2-10.5806
    1210B2 vs SCZ1-10.9812
    1210B2 vs SCZ1-20.9842
    201B7 vs BP1-11
    201B7 vs BP1-20.9998
    201B7 vs BP2-10.8884
    201B7 vs SCZ1-10.9037
    201B7 vs SCZ1-20.9149
    BP1-1 vs BP1-21
    BP1-1 vs BP2-10.902
    BP1-1 vs SCZ1-10.6069
    BP1-1 vs SCZ1-20.6541
    BP1-2 vs BP2-10.9712
    BP1-2 vs SCZ1-10.6265
    BP1-2 vs SCZ1-20.6636
    BP2-1 vs SCZ1-10.0941
    BP2-1 vs SCZ1-201225
    SCZ1-1 vs SCZ1-21
    No. of cells (GABA+βIII tubulin+/βIII tubulin+)Tukey’s test1210B2 vs 201B70.9415
    1210B2 vs BP1-10.2961
    1210B2 vs BP1-20.6938
    1210B2 vs BP2-10.2707
    1210B2 vs SCZ1-10.343
    1210B2 vs SCZ1-20.8786
    201B7 vs BP1-10.9599
    201B7 vs BP1-20.9994
    201B7 vs BP2-10.949
    201B7 vs SCZ1-10.9747
    201B7 vs SCZ1-21
    BP1-1 vs BP1-20.9981
    BP1-1 vs BP2-11
    BP1-1 vs SCZ1-11
    BP1-1 vs SCZ1-20.9345
    BP1-2 vs BP2-10.9967
    BP1-2 vs SCZ1-10.9994
    BP1-2 vs SCZ1-20.9993
    BP2-1 vs SCZ1-11
    BP2-1 vs SCZ1-20.9169
    SCZ1-1 vs SCZ1-20.9587
    Figure 3HPCDH15 gene expression (iPS)Dunnett’s testControl vs BP0.2334
    Control vs SCZ10.8567
    PCDH15 gene expression (neuron)Dunnett’s testControl vs BP0.3458
    Control vs SCZ0.5146
    RELN gene expression (iPS)Dunnett’s testControl vs BP0.999
    Control vs SCZ0.9874
    RELN gene expression (neuron)Dunnett’s testControl vs BP0.081
    Control vs SCZ0.0663
    Figure 5DDendrite lengthDunnett’s testControl vs BP0.0001
    Control vs SCZ0.0002
    Figure 5EHomer I puncta No.Dunnett’s testControl vs BP0.0093
    Control vs SCZ0.009
    Synapsin I puncta No.Dunnett’s testControl vs BP0.0067
    Control vs SCZ0.0014
    Homer I-Synapsin I puncta No.Dunnett’s testControl vs BP0.0182
    Control vs SCZ0.0117
    Figure 5HDendrite lengthDunnett’s testControl vs BP0.004
    Control vs SCZ0.0016
    Figure 5IGephyrin puncta No.Dunnett’s testControl vs BP0.0065
    Control vs SCZ0.0048
    Synapsin I puncta No.Dunnett’s testControl vs BP0.0173
    Control vs SCZ0.0099
    Gephyrin-Synapsin I puncta No.Dunnett’s testControl vs BP0.0044
    Control vs SCZ0.0042
    Figure 6EGene expression of PCDH15Student’s t testControl 1 vs PCDH15del (glutamatergic neurons)0.1757
    Control 1 vs PCDH15del (GABAergic neurons)0.01
    Figure 6GGene expression of RELNStudent’s t testControl 2 vs RELNdel (glutamatergic neurons)<0.0001
    Control 2 vs RELNdel (GABAergic neurons)0.0014
    Figure 7BNo. of cells (βIII tubulin+/HO+)Student’s t testControl 1 vs PCDH15del0.1781
    Control 1 vs RELNdel0.2969
    No. of cells (MAP2+/βIII tubulin+)Student’s t testControl 1 vs PCDH15del0.0003
    Control 1 vs RELNdel0.2568
    No. of cells (VGluT2+βIII tubulin+/βIII tubulin+)Student’s t testControl 1 vs PCDH15del0.0098
    Control 1 vs RELNdel0.2754
    Figure 7CDendrite lengthStudent’s t testControl 1 vs PCDH15del0.0418
    Control 1 vs RELNdel0.063
    Figure 7DHomer I puncta No.Student’s t testControl 1 vs PCDH15del0.0282
    Control 1 vs RELNdel0.0209
    Synapsin I puncta No.Student’s t testControl 1 vs PCDH15del0.2101
    Control 1 vs RELNdel0.3278
    Homer I-Synapsin I puncta No.Student’s t testControl 1 vs PCDH15del0.982
    Control 1 vs RELNdel0.7786
    Figure 7FNo. of cells (βIII tubulin+/HO+)Control 1 vs PCDH15del0.1441
    Control 1 vs RELNdel0.1954
    No. of cells (MAP2+/βIII tubulin+)Control 1 vs PCDH15del0.0281
    Control 1 vs RELNdel0.4007
    No. of cells (GABA+βIII tubulin+/βIII tubulin+)Control 1 vs PCDH15del0.1269
    Control 1 vs RELNdel0.66
    Figure 7GDendrite lengthStudent’s t testControl 1 vs PCDH15del0.0055
    Control 1 vs RELNdel0.9907
    Figure 7HGephyrin puncta No.Student’s t testControl 1 vs PCDH15del0.553
    Control 1 vs RELNdel0.0452
    Synapsin I puncta No.Student’s t testControl 1 vs PCDH15del0.2637
    Control 1 vs RELNdel0.0431
    Gephyrin-Synapsin I puncta No.Student’s t testControl 1 vs PCDH15del0.5136
    Control 1 vs RELNdel0.3123
    Figure 8BDendrite length (Glutamatergic neurons)Dunnett’s testControl vs BP0.0001
    Control vs SCZ0.0002
    Homer I puncta No.Dunnett’s testControl vs BP0.0003
    Control vs SCZ0.001
    Synapsin I puncta No.Dunnett’s testControl vs BP0.0011
    Control vs SCZ0.0012
    Homer I-Synapsin I puncta No.Dunnett’s testControl vs BP<0.0001
    Control vs SCZ<0.0001
    Dendrite length (GABAergic neurons)Dunnett’s testControl vs BP0.0021
    Control vs SCZ0.0027
    Gephyrin puncta No.Dunnett’s testControl vs BP0.0002
    Control vs SCZ0.0011
    Synapsin I puncta No.Dunnett’s testControl vs BP0.1728
    Control vs SCZ0.1023
    Gephyrin-Synapsin I puncta No.Dunnett’s testControl vs BP<0.0001
    Control vs SCZ<0.0001
    Figure 8ESpike frequencyDunnett’s testControl vs BP (day28)0.8839
    Control vs SCZ (day28)0.924
    Control vs BP (day42)0.7486
    Control vs SCZ (day42)0.9812
    Paired t testday28 vs day420.0104
    Figure 8FSpike frequencyDunnett’s testControl 1 vs PCDH15del (day28)0.6129
    Control 2 vs RELNdel (day28)0.7575
    Control 1 vs PCDH15del (day42)0.2678
    Control 2 vs RELNdel (day42)0.9187
    Paired t testday28 vs day420.0483
    Figure 8GSpike number ratio (CNQX)Dunnett’s testControl vs BP0.0351
    Control vs SCZ0.0479
    Spike number ratio (AP-5)Control vs BP0.1922
    Control vs SCZ0.1165
    Spike number ratio (GABA)Control vs BP0.1204
    Control vs SCZ0.0071
    Figure 8IΔFmaxDunnett’s test1210B2 vs BP1-10.9215
    1210B2 vs BP1-20.9233
    1210B2 vs BP2-11
    1210B2 vs SCZ1-10.9999
    1210B2 vs SCZ1-20.9997
    Spike frequencyDunnett’s test1210B2 vs BP1-10.2334
    1210B2 vs BP1-20.7435
    1210B2 vs BP2-10.9984
    1210B2 vs SCZ1-10.9985
    1210B2 vs SCZ1-21
    Figure 8JΔFmaxStudent’s t testControl 1 vs PCDH15del0.7346
    Control 1 vs RELNdel0.5067
    Spike frequencyStudent’s t testControl 1 vs PCDH15del0.0795
    Control 1 vs RELNdel0.3771
    • p Values <0.05 were considered to be statistically significant in this study.

Back to top

In this issue

eneuro: 6 (5)
eNeuro
Vol. 6, Issue 5
September/October 2019
  • Table of Contents
  • Index by author
  • Ed Board (PDF)
Email

Thank you for sharing this eNeuro article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
In Vitro Modeling of the Bipolar Disorder and Schizophrenia Using Patient-Derived Induced Pluripotent Stem Cells with Copy Number Variations of PCDH15 and RELN
(Your Name) has forwarded a page to you from eNeuro
(Your Name) thought you would be interested in this article in eNeuro.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
In Vitro Modeling of the Bipolar Disorder and Schizophrenia Using Patient-Derived Induced Pluripotent Stem Cells with Copy Number Variations of PCDH15 and RELN
Takaya Ishii, Mitsuru Ishikawa, Koki Fujimori, Takuji Maeda, Itaru Kushima, Yuko Arioka, Daisuke Mori, Yuhki Nakatake, Bun Yamagata, Shintaro Nio, Takahiro A. Kato, Nan Yang, Marius Wernig, Shigenobu Kanba, Masaru Mimura, Norio Ozaki, Hideyuki Okano
eNeuro 20 September 2019, 6 (5) ENEURO.0403-18.2019; DOI: 10.1523/ENEURO.0403-18.2019

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Share
In Vitro Modeling of the Bipolar Disorder and Schizophrenia Using Patient-Derived Induced Pluripotent Stem Cells with Copy Number Variations of PCDH15 and RELN
Takaya Ishii, Mitsuru Ishikawa, Koki Fujimori, Takuji Maeda, Itaru Kushima, Yuko Arioka, Daisuke Mori, Yuhki Nakatake, Bun Yamagata, Shintaro Nio, Takahiro A. Kato, Nan Yang, Marius Wernig, Shigenobu Kanba, Masaru Mimura, Norio Ozaki, Hideyuki Okano
eNeuro 20 September 2019, 6 (5) ENEURO.0403-18.2019; DOI: 10.1523/ENEURO.0403-18.2019
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Visual Abstract
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
    • Synthesis
    • Author Response
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • bipolar disorder
  • copy number variations
  • GABAergic neurons
  • glutamatergic neurons
  • induced pluripotent stem cells
  • schizophrenia

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

New Research

  • A Very Fast Time Scale of Human Motor Adaptation: Within Movement Adjustments of Internal Representations during Reaching
  • Optogenetic Activation of β-Endorphin Terminals in the Medial Preoptic Nucleus Regulates Female Sexual Receptivity
  • Hsc70 Ameliorates the Vesicle Recycling Defects Caused by Excess α-Synuclein at Synapses
Show more New Research

Disorders of the Nervous System

  • Alpha-2 Adrenergic Agonists Reduce Heavy Alcohol Drinking and Improve Cognitive Performance in Mice
  • The E-protein Daughterless regulates olfactory learning of adult Drosophila melanogaster
  • Lasting Increases in Neuronal Activity and Serotonergic Receptor Expression Following Gestational Chlorpyrifos Exposure
Show more Disorders of the Nervous System

Subjects

  • Disorders of the Nervous System
  • Home
  • Alerts
  • Follow SFN on BlueSky
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Latest Articles
  • Issue Archive
  • Blog
  • Browse by Topic

Information

  • For Authors
  • For the Media

About

  • About the Journal
  • Editorial Board
  • Privacy Notice
  • Contact
  • Feedback
(eNeuro logo)
(SfN logo)

Copyright © 2026 by the Society for Neuroscience.
eNeuro eISSN: 2373-2822

The ideas and opinions expressed in eNeuro do not necessarily reflect those of SfN or the eNeuro Editorial Board. Publication of an advertisement or other product mention in eNeuro should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in eNeuro.