Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT

User menu

Search

  • Advanced search
eNeuro
eNeuro

Advanced Search

 

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT
PreviousNext
Research ArticleNew Research, Disorders of the Nervous System

Nuclear Receptor Nr4a1 Regulates Striatal Striosome Development and Dopamine D1 Receptor Signaling

Maria-Daniela Cirnaru, Chiara Melis, Tomas Fanutza, Swati Naphade, Kizito-Tshitoko Tshilenge, Brian S. Muntean, Kirill A. Martemyanov, Joshua L. Plotkin, Lisa M. Ellerby and Michelle E. Ehrlich
eNeuro 20 September 2019, 6 (5) ENEURO.0305-19.2019; https://doi.org/10.1523/ENEURO.0305-19.2019
Maria-Daniela Cirnaru
1Department of Neurology, Icahn School of Medicine at Mount Sinai, New York, New York 10029
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Chiara Melis
1Department of Neurology, Icahn School of Medicine at Mount Sinai, New York, New York 10029
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Chiara Melis
Tomas Fanutza
1Department of Neurology, Icahn School of Medicine at Mount Sinai, New York, New York 10029
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Swati Naphade
2The Buck Institute for Research on Aging, Novato, California 94945
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kizito-Tshitoko Tshilenge
2The Buck Institute for Research on Aging, Novato, California 94945
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Brian S. Muntean
3Department of Neuroscience, The Scripps Research Institute, Jupiter, Florida 33458
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kirill A. Martemyanov
3Department of Neuroscience, The Scripps Research Institute, Jupiter, Florida 33458
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Kirill A. Martemyanov
Joshua L. Plotkin
4Department of Neurobiology and Behavior, Stony Brook University, Stony Brook, New York 11794
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lisa M. Ellerby
2The Buck Institute for Research on Aging, Novato, California 94945
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Michelle E. Ehrlich
1Department of Neurology, Icahn School of Medicine at Mount Sinai, New York, New York 10029
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Figure 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1.

    Nr4a1 mRNA is increased in Nr4a1-eGFP mice, and Nr4a2 mRNA is equal to wild type. qRT-PCR expression analysis of Nr4a1 and Nr4a2 in 4-month-old WT, Nr4a1-eGFP, and Nr4a1-null mice. n = 6 mice/genotype; one-way ANOVA corrected for multiple comparisons and Sidak’s post-test with genotype factor. For Nr4a1 expression: F(2,14) = 23.42, p < 0.0001; Nr4a2 expression: F(2,20) = 0.1871, p = 0.8308. *p = 0.0145, ***p = 0.0010. Data are presented as the mean ± SEM.

  • Figure 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2.

    Constitutive upregulation or downregulation of Nr4a1 mRNA alters spatial development of the striosomal compartment and mRNA levels of its markers in vivo. a, Coronal section of adult Nr4a1-eGFP/Drd1-tdTomato showing the colocalization of Drd1-tdTomato and Nr4a1-eGFP. The ROI selection indicates the section represented in higher magnification. Single channels are shown in the miniatures. Scale bars: 200 and 50 µm. b, Quantification of tdTomato+, EGFP+, and tdTomato++/EGFP+ cells in striosomes and matrix shown in a. Percentage of each cell population was calculated relative to the total number of cells counted by DAPI immunofluorescence. c, Graphic representation of the percentage distribution of Drd1+0/Nr4a1−, Drd1+/Nr4a1+, Drd2+/Nr4a1+, and Drd2+/Nr4a1− in the striosomes. For this, the Drd1 (i.e., tdTomato−) cells were counted as Drd2+ cells. d, Representative OPRM1 immunolabeling on 30-µm-thick coronal sections from 4-month-old WT, Nr4a1-eGFP, and Nr4a1-null mice with superimposition of selected ROIs delineating the total striatal and striosomal areas in the bottom panel. Scale bars, 200 µm. e, Quantification of the striatal area, the percentage of the area occupied by the striosomes, and of the number of striosomes in 4-month-old and P3 WT, Nr4a1-eGFP, and Nr4a1-null mice shows a decrease in the percentage of the area occupied by the striosomes in Nr4a1-null mice at both ages. For both P3 and adult analysis, n = 6 mice/genotype. One-way ANOVA corrected for multiple comparisons (Sidak’s test). For adults: striatal area F(2,15) = 1.897, p = 0.1943; striosomal area: F(2,15) = 40.83, p < 0.0001; WT vs Nr4a1-eGFP: t(15) = 0.1803, p = 0,8593; WT vs Nr4a1-null: t(15) = 7.914, ***p = 0.0001; number of striosomes: F(2,15) = 2.007, p = 0.1689. For P3: striatal area: F(2,19) = 1,5481, p = 0.2383; striosomal area: F(2,19) = 12.87, p = 0.0003; WT vs Nr4a1-eGFP: t(19) = 0.3318, p = 0.7437; WT vs Nr4a1-KO: t(19) = 4.333, **p = 0.0004; number of striosomes: F(2,15) = 2.818, p = 0.0914. Data are presented as the mean ± SEM. f, mRNA levels of striosome and matrix marker as determined by qRT-PCR of striatal mRNA from 4-month-old and P3 WT, Nr4a1-eGFP, and Nr4a1-null mice reveals a positive correlation between Nr4a1 expression levels and striosomal markers Oprm1 (F(2,20) = 15.52, p < 0.0001; followed by Sidak’s multiple-comparisons test vs WT: t(20) = 4.732, p = 0.0001 for Nr4a1-eGFP; t(20) = 1.099, p = 0.2848 for Nr4a1-KO), Rasgrp1 (F(2,11) = 16.49, p = 0.0005; t(11) = 4.082, p = 0.0018; t(11) = 1.639, p = 0.1295), and Foxp2 (F(2,11) = 20.02, p = 0.0002; t(11) = 2.795, p = 0.0174; t(11) = 3.174, p = 0.0089) in the adult. In P3, Nr4a1-KO mice have reduced levels of Ppp1r1b (F(2,15) = 13.96, p = 0.0004; t(15) = 2.899, p = 0.011), Calb1 (F(2,12) = 10.77, p = 0.0021; t(12) = 2.721, p = 0.0186), and Rasgrp1 (F(2,8) = 4.657, p = 0.0456; t(8) = 2.378, p = 0.0447). n ≥ 5 mice/genotype, one-way ANOVA corrected for multiple comparisons (Sidak’s test). *p < 0.05, **p < 0.01, ***p < 0.001. Data are presented as the mean ± SEM.

  • Figure 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3.

    Nr4a1 promotes the maturation of specific medium spiny neuronal phenotypes, including of Oprm1, a striosomal marker. a, qRT-PCR assay of Nr4a1, Ppp1r1b, and Oprm1 mRNAs on DIV7 WT and Nr4a1-eGFP primary striatal neurons treated with BDNF 25 ng/ml vs 0.1% BSA reveals that Nr4a1 is overexpressed in Nr4a1-eGFP neurons (F(3,15) = 10.15, p = 0.007; WT vs Nr4a1-eGFP: t(15) = 3695, p = 0.0022) and is associated with an increase in Ppp1r1b (F(3,27) = 10.04, p = 0.0001; WT vs Nr4a1-eGFP: t(27) = 2.910, p = 0.0072) and Oprm1 (F(3,13) = 17.77, p < 0.0001; WT vs Nr4a1-eGFP t(13) = 3.338, p = 0.0053). BDNF treatment is additive for both Ppp1r1b (WT vs WT+BDNF: t(27) = 2.729, p = 0.011; WT vs Nr4a1-eGFP+BDNF: t(27) = 5.479, p = 0.0001; Nr4a1-eGFP vs Nr4a1-eGFP+BDNF: t(27) = 2.688, p = 0.0127) and Oprm1 (WT vs Nr4a1-eGFP+BDNF: t(13) = 5.944, p = 0.0001). n = 5 samples/genotype. One-way ANOVA corrected for multiple comparisons (Sidak’s test): *p < 0.05, **p < 0.01, ****p < 0.0001. Data are presented as the mean ± SEM. b, Representative Pp1r1b/DARPP-32 staining on DIV7 WT and Nr4a1-eGFP primary striatal neurons treated with BDNF (25 ng/ml) shows a relatively increased number of DARPP-32-immunopositive cells in Nr4a1-eGFP primary cultures. The effects of increased Nr4a1 and BDNF are additive. Scale bars, 50 µm. c, Representative DARPP-32 immunolabeling of WT primary striatal neurons 96 h after transduction with ADV-GFP CT vs ADV-Nr4a1-eGFP showing increase in DARPP-32-immunopositive cells in the cultures overexpressing Nr4a1. Scale bars, 50 µm. d, qRT-PCR assay shows increases in Ppp1r1b (t(6) = 2.551, p = 0.0434) and Oprm1 (t(6) = 5.505, p = 0.0015) mRNA levels in wild-type primary striatal neurons 96 h after transduction with ADV-Nr4a1-GFP. n = 5 samples/treatment, two-tailed unpaired t test: *p < 0.05, **p < 0.01. Data are presented as the mean ± SEM.

  • Figure 4.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 4.

    Nr4a1 promotes the differentiation of MSNs phenotypes in human iPSC-derived NPCs into medium spiny neurons. a, Immunolabeling of DARPP-32 and βIII tubulin in iPSC-derived NSCs, untreated, vs transduction with ADV-GFP or ADV-NR4A1-GFP shows that Nr4a1 induces the upregulation of DARPP-32 and βIII tubulin. Scale bar, 100 µm. b, qRT-PCR assays show an increase in Ppp1r1b (F(2,6) = 7.173, p = 0.0256; NT vs Nr4a1-GFP: t(6) = 3.691, p = 0.0102), Oprm1 (F(2,6) = 6.105, p = 0.0358; NT vs Nr4a1-GFP: t(6) = 3.234, p = 0.0178), Calb2 (F(2,6) = 15.75, p = 0.0041; NT vs Nr4a1-GFP: t(6) = 5.461, p = 0.0016; GFP-CT vs Nr4a1-GFP: t(6) = 3.854, p = 0.008), Calb1 (F(2,5) = 72.94, p = 0.0002; NT vs Nr4a1-GFP: t(5) = 11.63, p = 0.0001; GFP vs Nr4a1-GFP: t(5) = 4.357, p = 0.0073), and Bcl11b (F(2,6) = 13.69, p = 0.0058; NT vs Nr4a1-GFP: t(6) = 4.848, p = 0.0029; GFP vs Nr4a1-GFP: t(6) = 4.132, p = 0.0068) mRNA levels in human iPSC-derived NSCs transduced with ADV-Nr4a1-GFP for 14 d. n = 3 samples for each group. One-way ANOVA corrected for multiple comparisons (Tukey’s test): *p < 0.05, **p < 0.01, ***p < 0.001. Data are presented as the mean ± SEM.

  • Figure 5.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 5.

    Nr4a1 overexpression reduces the induction of phosphorylation of ERK and c-fos after acute cocaine injection and impairs locomotor sensitization to chronic cocaine. a, Representative pERK immunolabeling indicating the dorsomedial region of interest and fixed area used for the quantification of pERK+ cells in the striatum of 4-month-old WT, Nr4a1-eGFP, and Nr4a1-null mice 10 min after a single intraperitoneal injection of cocaine (20 mg/kg). Scale bars: 200 and 50 µm. b, Quantification of a showing a relative reduced induction of pERK+ cells in Nr4a1-eGFP mice (F(2,8) = 7.281, p = 0.0158; WT vs Nr4a1-eGFP: t(8) = 3.816, p = 0.0051). n = 4 mice/genotype; one-way ANOVA corrected for multiple comparisons (Bonferroni’s correction): *p < 0.05. Data are presented as the mean ± SEM. c, ERK 1/2 basal protein levels are equal in 4-month-old WT, Nr4a1-eGFP, and Nr4a1-null mice (F(2,9) = 1.340, p = 0.3094). n = 8 mice/genotype. One-way ANOVA corrected for multiple comparisons (Sidak’s test). Data are presented as the mean ± SEM. d, Calbindin and pERK immunolabeling shows that the induction of pERK occurs predominantly in the matrix compartment after a single intraperitoneal injection of cocaine (20 mg/kg). Scale bars, 100 µm. The graph shows the quantification of pERK+ cells in matrix and striosomes in sections from bregma 0.86 mm. n =3 mice, unpaired t test: t(2.003) = 4.702, *p = 0.0423. Data are presented as the mean ± SEM. e, c-fos and GFP immunolabeling in the dorsal striatum of Drd1-eGFP and Nr4a1-eGFP adult mice 1 h after a single intraperitoneal injection of cocaine (20 mg/kg), indicating relatively reduced c-fos induction in Nr4a1-eGFP mice. Arrows indicate c-fos labeling in the GFP+ striosomes in the Nr4a1-eGFP mice. Scale bars, 50 µm. f, Quantification of c-fos + cells in Drd1-eGFP and Nr4a1-eGFP adult mice shown in e. n = 3 mice/genotype and treatment, unpaired t test: t(4) = 6.721, **p = 0.0026. Data are presented as the mean ± SEM. g, pERK immunostaining in WT and Nr4a1-eGFP mice after the injection NMDA antagonist MK-801(0.1 mg/kg) followed 30 min later by a single injection of cocaine (20 mg/kg) shows the abolition of pERK induction. Scale bars, 50 µm. h, Schematic representation of treatments used for the induction of locomotor sensitization to cocaine. i, Nr4a1-eGFP mice show decreased locomotor sensitization to chronic cocaine use relative to WT mice. One-way ANOVA corrected for multiple comparisons (Bonferroni’s correction; F(7,108) = 8.639, p < 0.0001; WT cocaine day 1 vs WT cocaine day 5: t(108) = 3.705, **p = 0.003; Nr4a1-eGFP cocaine day 1 vs Nr4a1-eGFP cocaine day 5: t(108) = 0.6920, p = 0.4904). n = 15 mice/genotype, One-way ANOVA corrected for multiple comparisons (Bonferroni’s correction). Data are presented as the mean ± SEM. ns = non-significant.

  • Figure 6.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 6.

    Characterization of electrophysiological properties of dorsomedial striosomal MSNs and the impact of Nr4a1 overexpression on striatal synaptic excitability and plasticity. a, Action potential sample traces from single cells derived from the dorsal striatum in WT mice and in the center of the striosomes for GFP+ and GFP– neurons from Nr4a1-eGFP mice. b, Number of action potentials as a function of injected current intensity in WT, GFP+, and GFP– neurons indicate that neuronal action potentials are increased in GFP+ neurons. Two-way ANOVA with genotype factor (F(2,57) = 7.421, p = 0.0014). n ≥ 17/genotype and cell type; **p < 0.01. Data are presented as the mean ± SEM. c, Resting membrane potential is more depolarized in GFP+ neurons compared with WT (WT MSNs: average, −75.8 mV, n = 17 cells; GFP+ MSNs: average, −71.7mV, n = 22; GFP− MSNs: average, −74.2 mV, n = 21). One-way ANOVA followed by Bonferroni’s multiple-comparisons test: F(2,55) = 4.303, p = 0.0183, *p < 0.05. Data are presented as the mean ± SEM. d, Rheobase current is lower in GFP+ neurons relative to WT and GFP− MSNs (WT MSNs: average, 171.1 pA, n = 17 cells; GFP+ MSNs: average, 134.1 pA, n = 22; GFP− MSNs: average, 164.7 pA, n = 21). One-way ANOVA-Bonferroni’s multiple-comparison test, F(2,51) = 4.342, p = 0.0181; *p < 0.05. Data presented as ± SEM. e, Membrane resistance recorded in voltage-clamp experiments is equal in the three cell types. WT, n = 10; GFP+ and GFP−, n = 16. One-way ANOVA-Bonferroni’s multiple-comparison test: F(2,50) = 0.7388, p = 0.4828. Data are presented as the mean ± SEM. f, Spike threshold is equal in the three cell types. WT, n = 15; GFP+ and GFP−, n = 19. One-way ANOVA-Bonferroni’s multiple-comparison test: F(2,49) = 0.5219, p = 0.5967. Data are presented as the mean ± SEM. g, Whole-cell patch-clamp recordings of long-term synaptic depression (LTD) induced by high-frequency stimulation in WT and GFP+ MSNs showing overlapping traces for both genotypes. Data are presented as the mean ± SEM. h, Bar graph representing the average of the last 5 min after LTD induction in WT and GFP+ MSNs indicating no significant differences between the two groups: WT, 10 recordings/7 mice; GFP+, 7 recordings/3 mice. Unpaired two-tailed t test, t(15) = 1.868, p = 0.0815. Data are presented as the mean ± SEM. i, LTP assayed in field recordings in WT and Nr4a1-eGFP shows reduced LTP in Nr4a1-eGFP mice after high-frequency stimulation. Data are presented as the mean ± SEM. j, Bar graph representing the average of the last 5 min after LTP induction in field recordings (7 recordings and 3 mice for both genotypes). Unpaired two-tailed t test: t(12) = 3.011, p = 0.0108; *p < 0.05; Data are presented as the mean ± SEM.

  • Figure 7.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 7.

    Nr4a1 overexpression impacts the activation of Drd1signaling. a, qRT-PCR assay of mRNA levels of Drd1 signaling pathway components in the striatum of 4-month-old WT, Nr4a1-eGFP, and Nr4a1-null mice shows a decrease of Drd1 (F(2,21) = 4.755, p = 0.0198; t(21) = 3.084, p = 0.0056) and Adyc5, and an increase of Ppp1cc (F(2,24) = 7.275, p = 0.0034; t(24) = 3.301, p = 0.003) and Ptpn5 (F(2,24) = 10.15, p = 0.0006; t(24) = 4332, p = 0.0002) in Nr4a1-eGFP mice. n ≥ 5 mice/genotype; One-way ANOVA corrected for multiple comparisons (Sidak’s test): *p < 0.05, **p < 0.01, ***p < 0.001. Data are presented as the mean ± SEM. b, Western blot of AC5 protein shows equal levels in WT and Nr4a1-eGFP striatum, normalized to GAPDH. Unpaired t test, t(7) = 0.6399, p = 0.5426; n ≥ 4/genotype. Data are presented as the mean ± SEM. The basal striatal cAMP level in Nr4a1-eGFP mice is equal to wild type. Unpaired t test, t(8) = 1.367, p = 0.2089. n ≥ 4/genotype. Data are presented as the mean ± SEM. c, AC5 activity on Drd1 stimulation with SKF38393 indicates a reduction of the response in Nr4a1-eGFP mice. n = 3 mice/genotype. Two-way ANOVA corrected for multiple comparisons (Sidak’s test) F(1,4) = 25.96, p = 0.007, t(8) = 4.659, **p = 0.0016. Data are presented as the mean ± SEM. d, E50 and AC5 stimulation efficacy in striatal membrane preparation from Nr4a1-eGFP and wild-type mice, showing a decrease in AC5 efficacy in Nr4a1-eGFP mice. n = 3 mice; unpaired t test, t(4) = 3.484, *p = 0.0253. Data are presented as the mean ± SEM. e, Gs-GTPγS and Forskolin AC5 activity–titration curves in striatal membrane preparation from Nr4a1-eGFP and wild-type mice, indicating a reduced AC5 activation plateau in Nr4a1-eGFP mice. n = 3 mice. Two-way ANOVA corrected for multiple comparisons (Sidak’s test) genotype factor forskolin: F(1,12) = 12.76, p = 0.0038; at 10 mm: t(12) = 3.941, p = 0.002; Gαs-GTPγS: F(1,24) = 35.19, p < 0.0001; at 0.1 and 0.5 μm: t(24) = 2.711, **p = 0.0122; and 1 μm: t(24) = 3650, ***p = 0.0013. Data are presented as the mean ± SEM.

Tables

  • Figures
    • View popup
    Table 1.

    qRT-PCR primers sequence

    GenePrimer forward 5´-3´Primer reverse 5´-3´
    Adcy5 GGCAGCTGGAAAAGATCAAG CCAGCCACTACAGGTCCAAT
    Calb 1 ACTCTCAAACTAGCCGCTGCA TCAGCGTCGAAATGAAGCC
    Rasgrp1 GGACCTACCAAGAACTGGAA C GATCCCAGTAAACCCGTCTG
    Ppp1r1b GAAGAAGAAGACAGCCAGGC TAGTGTTGCTCTGCCTTCCA
    Drd1 TTCTTCCTGGTATGGCTTGG GCTTAGCCCTCACGTTCTTG
    Drd2 TGGACTCAACAACACAGACCAGAATG GATATAGACCAGCAGGTTGACGATGA
    GAPDH AACGACCCCTTCATTGACCT TGGAAGATGGTGATGGGCTT
    Foxp2 AAGCAGCTTGCCTTTGCTAAG GGATTGAATGTATGTGTGGCTGA
    Oprm1 CCCTCTATTCTATCGTGTGTGT AGAAGAGAGGATCCAGTTGCA
    Ppp1cc CATCGACAGCATCATCCAAC GGAAAGCCACCGTATTCAAA
    Nr4a1 ATGCCTCCCCTACCAATCTTC CACCAGTTCCTGGAACTTGGA
    Nr4a2 CAGCTCGAGCCACATAAACA TCCTTGTCCGCTCTCTTCAT
    Ptpn5 CTCTGGACCCTTTCTTGCTG GGATCTTCAGGGTCTGGTGA
    • View popup
    Table 2.

    qRT-PCR human primer sequences

    GenePrimer forward 5´-3´Primer reverse 5´-3´
    Ppp1r1b CACACCACCTTCGCTGAAA GAAGCTCCCCCAGCTCAT
    Oprm1 AGAAACAGCAGGAGCTGTGG ACCGAGACTTTTCGGGTTC
    Calb2 GAAAATCGAGATGGCAGAGC CATAAACTCGGCGCTGGA
    Calb1 CACAGCCTCACAGTTTTTCG CCTTTCCTTCCAGGTAACCA
    Bcl11b CCCAGAGGGAGCTCATCAC GACACTGGCCACAGGTGAG
    ACTB CCAACCGCGAGAAGATGA TCCATCACGATGCCAGTG
Back to top

In this issue

eneuro: 6 (5)
eNeuro
Vol. 6, Issue 5
September/October 2019
  • Table of Contents
  • Index by author
  • Ed Board (PDF)
Email

Thank you for sharing this eNeuro article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Nuclear Receptor Nr4a1 Regulates Striatal Striosome Development and Dopamine D1 Receptor Signaling
(Your Name) has forwarded a page to you from eNeuro
(Your Name) thought you would be interested in this article in eNeuro.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
Nuclear Receptor Nr4a1 Regulates Striatal Striosome Development and Dopamine D1 Receptor Signaling
Maria-Daniela Cirnaru, Chiara Melis, Tomas Fanutza, Swati Naphade, Kizito-Tshitoko Tshilenge, Brian S. Muntean, Kirill A. Martemyanov, Joshua L. Plotkin, Lisa M. Ellerby, Michelle E. Ehrlich
eNeuro 20 September 2019, 6 (5) ENEURO.0305-19.2019; DOI: 10.1523/ENEURO.0305-19.2019

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Share
Nuclear Receptor Nr4a1 Regulates Striatal Striosome Development and Dopamine D1 Receptor Signaling
Maria-Daniela Cirnaru, Chiara Melis, Tomas Fanutza, Swati Naphade, Kizito-Tshitoko Tshilenge, Brian S. Muntean, Kirill A. Martemyanov, Joshua L. Plotkin, Lisa M. Ellerby, Michelle E. Ehrlich
eNeuro 20 September 2019, 6 (5) ENEURO.0305-19.2019; DOI: 10.1523/ENEURO.0305-19.2019
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Footnotes
    • References
    • Synthesis
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • dopamine receptor D1
  • ERK
  • Nr4a1
  • signal
  • striosome
  • transduction

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

New Research

  • A Very Fast Time Scale of Human Motor Adaptation: Within Movement Adjustments of Internal Representations during Reaching
  • Hsc70 Ameliorates the Vesicle Recycling Defects Caused by Excess α-Synuclein at Synapses
  • TrkB Signaling Influences Gene Expression in Cortistatin-Expressing Interneurons
Show more New Research

Disorders of the Nervous System

  • Alpha-2 Adrenergic Agonists Reduce Heavy Alcohol Drinking and Improve Cognitive Performance in Mice
  • The E-protein Daughterless regulates olfactory learning of adult Drosophila melanogaster
  • Lasting Increases in Neuronal Activity and Serotonergic Receptor Expression Following Gestational Chlorpyrifos Exposure
Show more Disorders of the Nervous System

Subjects

  • Disorders of the Nervous System
  • Home
  • Alerts
  • Follow SFN on BlueSky
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Latest Articles
  • Issue Archive
  • Blog
  • Browse by Topic

Information

  • For Authors
  • For the Media

About

  • About the Journal
  • Editorial Board
  • Privacy Notice
  • Contact
  • Feedback
(eNeuro logo)
(SfN logo)

Copyright © 2026 by the Society for Neuroscience.
eNeuro eISSN: 2373-2822

The ideas and opinions expressed in eNeuro do not necessarily reflect those of SfN or the eNeuro Editorial Board. Publication of an advertisement or other product mention in eNeuro should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in eNeuro.