Article Figures & Data
Figures
- Figure 1.
FL behavioral observation experiments. A, Schematic representation of the in vitro preparation. The specimen has skin over all its face, neck and FL, and the FL are free to move. 5G, trigeminal ganglion; Stim, stimulation. B, Serial photographs taken from video of either uncoordinated (upper rows) or rhythmic (left-right alternation; lower rows) responses after stimulation. Arrows indicate the direction of paw movements.
- Figure 2.
EMG experiments. A, Schematic representation of the preparations used in EMG recordings. FL were pinned on the bath floor (bath not illustrated) so as to limit movements. Skin was removed on the neck and FL, and EMG electrodes were implanted in triceps muscles. 5G, trigeminal ganglion; Stim, stimulation. B, Muscle activity following a stimulation. Bottom black trace, stimulation artifact produced by the pedal; red trace, raw recording from one EMG; blue trace, same trace as in red, but rectified and with a reduced sampling rate. The dashed lines delimitate the duration of the response used for analysis. C–E, Processed traces exemplifying reactions to stimulation of the left (L) and right (R) triceps muscles of the same animal: no-response (C), uncoordinated response (D), and rhythmic response (E). In B–E, the arrowheads indicate the beginning of the stimulation. The magenta lines in E are envelopes of burst responses highlighting the rhythmical alternation (not to scale with EMG traces).
- Figure 3.
Percentage of FL responses of (A) 13 newborn opossums after cold (blue: 4°C, 21°C), neutral (orange: 25°C; bath temperature), or hot (red: 34°C) stimulations; (B) five of these specimens were tested for cold (4°C) both before and after trigeminal nerve transection (-5N) and, then, after spinal transection caudal to the obex (-obex). Each dot represents one specimen. Whisker plots stand for mean ± SEM, and thick horizontal lines indicate statistical differences between columns (Extended Data Fig. 3-1A,B); *p < 0.05, **p < 0.01, ****p < 0.0001.
- Figure 4.
Percentage of FL responses after cold (blue: 4°C), neutral (orange: 22°C; bath temperature) or hot (red: 45°C) stimulations (A) before and after transection of the spinal cord caudal to the obex (-obex) alone, or (B) after facial skin removal (-skin) followed by spinal transection. Each panel represents a series of experiments during which the specimens were consecutively stimulated. In both panels, each dot represents one specimen and whisker plots stand for mean ± SEM, and thick horizontal lines indicate statistical differences between columns (Extended Data Fig. 3-1C,D); *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
- Figure 5.
Response rates for all responses (“uncoordinated + rhythmic”; black columns) and rhythmic responses only (gray columns) after thermal stimulations (Stim T°) for all FL movements experiments (Extended Data Fig. 4-1). The neutral temperatures ([Bath T°]) are given for all cases. -5N, transection of the trigeminal nerve; -obex, transection of the neuraxis, caudally to the obex; -skin, removal of facial skin.
- Figure 6.
EMG recordings of the triceps muscles following thermal stimulations. A, Response amplitudes to cold (blue: 4°C) or neutral (orange: 22°C; bath temperature), and hot (red: 45°C) temperatures before and after trigeminal nerve transection (-5N) and, then, after spinal transection caudal to the obex (-obex). The amplitude given represents the average of individual muscle responses that were normalized to the highest response amplitude for that muscle during the series of experiments. B, EMG amplitude of responses to cold, neutral, and hot temperature before (plain columns) and after (checkered columns) no-responses (amplitudes = 0) were removed from the analysis. In all panels, whisker plots stand for mean ± SEM, and thick horizontal lines indicate statistical differences between columns (Extended Data Fig. 5-1A,B); ***p < 0.001, ****p < 0.0001.
- Figure 7.
Latencies of EMG responses after cold, neutral, and hot stimulations; each dot represents one triceps muscle response. In all panels, whisker plots stand for mean ± SEM, and thick horizontal lines indicate statistical differences between columns (Extended Data Fig. 6-1A); ****p < 0.0001.
- Figure 8.
TRPM8 immunoreactivity in transverse sections of cephalic tissues of newborn opossums. A–D, Trigeminal ganglia (approximately delineated by a dashed line) at P1 (A), P9 (B), and P13 (C, D) processed with (A–C) or without (D) the primary antibody against TRPM8. Labeled cell bodies are present only at P13 (examples pointed by arrowheads in C). The inset in C shows some labeled cell bodies at higher magnification. E, Labeled apical membrane of epithelial cells (empty arrowheads) in the trachea of a P9 opossum. F, Snout from a P9 opossum showing diffuse TRPM8 labeling in the epidermis (between empty arrowheads). Arrows in A, B, D–F point to blood vessels intrinsically fluorescent. Scale bar in F = 100 μm (for A–F).
- Figure 9.
RT-PCR gels of GAPDH and TRPM8 in the head of young opossums (P1, P12) and in the testes of an adult (T), illustrating the absence of TRPM8 mRNA expression at young ages.
Tables
Gene Sequence (5’-3’) GAPDH Forward: TAAATGGGGAGATGCTGGAG Reverse: GCCAGCATCGAAGGTAGAAG TRPM8 Forward: GGTCATTTGGGAGCAGACGA Reverse: ATCCATGAGCAGCACGTAGG Figure Description Data structure Type of test p value A 3A Comparison between stimulations at cold (4°C), cool (21°C) neutral (25°C), hot (34°C) Paired, non-parametric Kruskal–Wallis ANOVA <0.0001 Cold vs cool Dunn’s post hoc test n.s. Cold vs neutral Dunn’s post hoc test <0.0001 Cold vs hot Dunn’s post hoc test <0.0001 Cool vs neutral Dunn’s post hoc test <0.01 Cool vs hot Dunn’s post hoc test <0.01 Neutral vs hot Dunn’s post hoc test n.s. B 3B Comparison between cold stimulations (4°C), cold -5N, and cold -obex Paired, non-parametric Kruskal–Wallis ANOVA 0.0411 Cold vs cold -5N Dunn’s post hoc test n.s. Cold vs cold -obex Dunn’s post hoc test < 0.05. Cold -5N vs cold -obex Dunn’s post hoc test n.s. C 4A Comparison between stimulations at cold (4°C), neutral (22°C), hot (45°C), and cold -obex Paired, non-parametric Friedman ANOVA <0.0001 Cold vs neutral Dunn’s post hoc test <0.001 Cold vs hot Dunn’s post hoc test <0.001 Cold vs cold -obex Dunn’s post hoc test n.s. Neutral vs hot Dunn’s post hoc test n.s. Neutral vs cold -obex Dunn’s post hoc test <0.05 Hot vs cold -obex Dunn’s post hoc test n.s. D N/A Comparison between responses in Figures 3, 4A when different temperatures are used Non-parametric Neutral 22°C vs neutral 25°C Kolmogorov–Smirnov t test 0.2644 Hot 34°C vs 45°C Kolmogorov–Smirnov t test 0.0495 -obex with bath at 25°C vs 22°C Kolmogorov–Smirnov t test <0.01 E N/A Comparison of response rates to cold (4°C) and neutral (22°C) following anesthesia by hypothermia or isoflurane Non-parametric Cold hypothermia vs isoflurane Kolmogorov–Smirnov t test 0.3077 Neutral hypothermia vs isoflurane Kolmogorov–Smirnov t test 0.3874 F 4B Comparison between stimulations at cold (4°C), neutral (22°C), hot (45°C), cold -skin, neutral -skin, hot -skin, and cold -obex Paired, non-parametric Friedman ANOVA <0.0001 Cold vs neutral Dunn’s post hoc test <0.01 Cold vs hot Dunn’s post hoc test <0.01 Cold vs cold -skin Dunn’s post hoc test n.s. Cold vs neutral -skin Dunn’s post hoc test <0.0001 Cold vs hot -skin Dunn’s post hoc test <0.0001 Cold vs cold -obex Dunn’s post hoc test <0.001 Neutral vs hot Dunn’s post hoc test n.s. Neutral vs cold -skin Dunn’s post hoc test <0.05 Neutral vs neutral -skin Dunn’s post hoc test n.s. Neutral vs hot -skin Dunn’s post hoc test n.s. Neutral vs cold -obex Dunn’s post hoc test n.s. Hot vs cold -skin Dunn’s post hoc test <0.05 Hot vs neutral -skin Dunn’s post hoc test n.s. Hot vs hot -skin Dunn’s post hoc test n.s. Hot vs cold -obex Dunn’s post hoc test n.s. Cold -skin vs neutral -skin Dunn’s post hoc test <0.0001 Cold -skin vs hot -skin Dunn’s post hoc test <0.001 Cold -skin vs cold -obex Dunn’s post hoc test <0.01 Neutral -skin vs hot -skin Dunn’s post hoc test n.s. Neutral -skin vs cold -obex Dunn’s post hoc test n.s. Hot -skin vs cold -obex Dunn’s post hoc test n.s. Cold vs cold-skin Wilcoxon t test 0.25 Cold vs cold -obex Wilcoxon t test 0.0010 Hot vs hot -skin Wilcoxon t test 0.0898 Neutral vs neutral -skin Wilcoxon t test 0.0078 Cold -skin vs cold-obex Wilcoxon t test 0.0015 G 6A EMG amplitudes for cold (4°C), neutral (22°C), hot (45°C) cold -5N, neutral -5N, hot -5N, and cold -obex Unpaired, non-parametric Kruskal–Wallis ANOVA <0.0001 Cold vs neutral Dunn’s post hoc test <0.0001 Cold vs hot Dunn’s post hoc test <0.0001 Cold vs cold -5N Dunn’s post hoc test <0.0001 Cold vs neutral -5N Dunn’s post hoc test <0.0001 Cold vs hot-5N Dunn’s post hoc test <0.0001 Cold vs cold -obex Dunn’s post hoc test <0.0001 Neutral vs hot Dunn’s post hoc test n.s Neutral vs cold -5N Dunn’s post hoc test <0.0001 Neutral vs neutral -5N Dunn’s post hoc test <0.01 Neutral vs hot -5N Dunn’s post hoc test n.s. Neutral vs cold -obex Dunn’s post hoc test n.s. Hot vs cold -5N Dunn’s post hoc test <0.001 Hot vs neutral -5N Dunn’s post hoc test <0.01 Hot vs hot -5N Dunn’s post hoc test n.s. Hot vs cold -obex Dunn’s post hoc test n.s. Cold -5N vs neutral -5N Dunn’s post hoc test <0.0001 Cold -5N vs hot-5N Dunn’s post hoc test <0.0001 Cold -5N vs cold -obex Dunn’s post hoc test <0.001 Neutral -5N vs hot -5N Dunn’s post hoc test n.s. Neutral -5N vs cold -obex Dunn’s post hoc test <0.05 Hot -5N vs cold -obex Dunn’s post hoc test n.s. H 6B EMG amplitudes comparisons for cold (4°C), neutral (22°C), hot (45°C) when all responses are considered and when only responses >0 are considered Cold vs cold >0 Kolmogorov–Smirnov t test 0.9998 Neutral vs neutral >0 Kolmogorov–Smirnov t test <0.0001 Hot vs hot >0 Kolmogorov–Smirnov t test <0.0001. I 7 Comparisons of latencies for cold (4°C), neutral (22°C), and hot (45°C) Unpaired, non-parametric Kruskal–Wallis ANOVA <0.0001 Cold vs neutral Dunn’s post hoc test <0.0001 Cold vs hot Dunn’s post hoc test <0.0001 Neutral vs hot Dunn’s post hoc test <0.0001 J N/A Comparison of amplitudes after cold (4°C) stimulations for right and left FL Unpaired, non-parametric Kolmogorov–Smirnov t test 0.1726 K N/A Comparison of latencies after cold (4°C) stimulations for right and left FL Unpaired, non-parametric Kolmogorov–Smirnov t test 0.6001 -5N, trigeminal transection; -obex, complete transection of the spinoencephalic junction, caudal to the obex; -skin, facial skin removal; N/A, non-applicable; n.s., not significant.
Movies
- Movie 1.
Ejection of liquid at bath temperature (22°C) toward the snout of an in vitro preparation of a P1 opossum do not induce motor response. The stimulation starts at the beginning of the video.
- Movie 2.
Uncoordinated response of the limbs induced by ejection of cold liquid (4°C) toward the snout of an in vitro preparation of a P1 opossum. The stimulation starts at the beginning of the video.
- Movie 3.
Rhythmic response of the limbs induced by ejection of cold liquid (4°C) toward the snout of an in vitro preparation of a P1 opossum. The stimulation starts at the beginning of the video.
Extended Data Figure 3-1
FL response rates for behavioral observation experiments. Download Figure 3-1, DOCX file.
Extended Data Figure 4-1
FL responses - either all responses (uncoordinated + rhythmic) or rhythmic responses only - induced by temperature in 34 in vitro preparations of newborn opossums in proportion of total stimulations. Download Figure 4-1, DOCX file.
Extended Data Figure 5-1
Amplitude of EMG responses to different temperatures. Download Figure 5-1, DOCX file.
Extended Data Figure 6-1
Latency of FL responses after temperature stimulations for EMG recordings. Download Figure 6-1, DOCX file.
In this issue
