Article Figures & Data
Figures
- Figure 1.
Inhibiting BMP4/BMPRI signaling following demyelination promotes remyelination in vivo. A, Representative MBP IHC images showing myelin protein in the caudal corpus callosi of healthy control (control) and 5 week cuprizone-challenged mice (Cuprizone 5w, top panels); and 5 week cuprizone-challenged mice followed by 1 week of recovery with vehicle (Vehicle recovery) or LDN-193189 (LDN recovery) infusion (bottom panels). B, Quantification of integrated density of MBP immunostaining. No significant differences were observed between control and cuprizone-fed mice, or between vehicle- and LDN-infused mice. C, Representative SCoRe images to identify myelin in the caudal corpus callosi of healthy control (control) and 5 week cuprizone-challenged mice (Cuprizone (5w), top panels); and 5 week cuprizone-challenged mice followed by 1 week of recovery with vehicle (Vehicle recovery) or LDN-193189 (LDN recovery) infusion (bottom panels). D, Quantification of myelinated area (SCoRe signal that is pixelated) as a percentage of the total area measured. The SCoRe signal is significantly reduced in 5 week cuprizone-challenged mice [Cuprizone (5w) compared with healthy control (Ctrl) mice, confirming demyelination (B)]. LDN-193189-infused mice display a significantly greater SCoRe signal than the vehicle-infused control group (C), indicating greater remyelination. E, TEM cross-sectional images of caudal corpus callosum axons of 5 week cuprizone-challenged mice followed by 1 week of recovery with vehicle (Vehicle recovery) or LDN-193189 (LDN recovery) infusion. F, A scatterplot comparison of g-ratio distribution relative to axonal diameter. LDN-infused mice had a significantly higher average g-ratio than vehicle-infused controls (p = 0.016). G, Proportion of total myelinated axons in the caudal corpus callosum of vehicle- and LDN-infused mice following 5 weeks of cuprizone administration. A trend, but a nonsignificant increase, was observed in LDN-infused mice compared with vehicle controls. H, The average g-ratio of axons in the caudal corpus callosum of vehicle- and LDN-infused mice following 5 weeks of cuprizone treatment. Mice treated with LDN-193189 after 5 weeks of cuprizone had more thinly myelinated axons (high g-ratio) in the corpus callosum compared with vehicle-infused mice. I, Number of axons in the corresponding g-ratio range for vehicle- versus LDN-infused mice following 5 weeks of cuprizone treatment. EM analysis indicated a higher number of axons with thinner myelin in the LDN-treated group, indicating greater remyelination (N = 4-6 animals/group for SCoRe; N = 3 animals/group for EM). *p < 0.05, ****p < 0.0001. Scale bars: SCoRe images, 50 µm; TEM images, 2 µm.
- Figure 2.
Inhibiting BMP4/BMPRI signaling following demyelination promotes oligodendrocyte differentiation in vivo. A, Representative micrographs of immunostaining in the caudal corpus callosi of healthy control mice (control), mice subjected to 5 weeks of cuprizone treatment (Cuprizone 5w), and mice subjected to 5 weeks of cuprizone with either vehicle (Vehicle recovery) or LDN-193189 (LDN recovery) infusion for 1 week, and immunostained with OLIG2 and either PDGFRα or CC1. B, C, Analysis of OLIG2+ cell number in healthy control mice (control), mice subjected to 5 weeks of cuprizone treatment (Cuprizone 5w), and mice infused with either vehicle (Vehicle recovery) for 1 week or LDN-193189 (LDN recovery) for 1 week. As expected, the total number of OLIG2+ cells is significantly decreased after 5 weeks of cuprizone treatment compared with controls. D, Quantification of the proportion of OLIG2+/CC1+ mature oligodendrocytes showing a significant reduction at the end of cuprizone feeding. E, LDN-193189-infused mice have a significantly higher proportion of mature oligodendrocytes compared with the vehicle control group following 1 week recovery. F, Quantification of the proportion of OLIG2+/PDGFRα+ OPCs showing a significant increase at the end of cuprizone feeding. G, LDN-193189-infused mice have a significantly smaller fraction of OPCs compared with the vehicle control group following recovery (N = 4-6 animals/group). *p < 0.05, **p < 0.01, ***p < 0.001. Scale bar, 50 µm.
- Figure 3.
Inhibiting BMP4/BMPRI signaling exerts no influence on astrocytes or microglia in vivo. A, B, Representative micrographs of immunostaining in the caudal corpus callosi of healthy control mice (control), mice subjected to 5 weeks of cuprizone treatment (Cuprizone 5w), and mice subjected to 5 weeks of cuprizone treatment with either vehicle (Vehicle recovery) or LDN-193189 (LDN recovery) infusion for 1 week, and immunostained with GFAP (A) or IBA-1 (B). C, Quantification of the integrated density of GFAP immunofluorescence. There is no significant change in GFAP immunofluorescence at peak demyelination (Cuprizone 5w; left) or following the infusion of LDN-193189 (LDN recovery) for 1 week compared with control groups (Control, Vehicle; right panel). D, Quantification of the integrated density of IBA-1 immunofluorescence. There is a significant increase in IBA-1 immunofluorescence in the corpus callosum at peak demyelination (Cuprizone 5w; left); however, there is no significantly different increase in IBA-1 immunofluorescence between vehicle (Vehicle recovery) or LDN-193189 (LDN recovery) infusion during 1 week of recovery after cuprizone treatment (right; N = 4-6 animals/group). ****p < 0.0001. Scale bar, 50 µm.
- Figure 4.
BMP4 signals via BMPR1 in OPCs to enhance oligodendrocyte differentiation and reduce astrogliogenesis in vitro. A, Representative micrographs of immunostaining of differentiated OPC cultures for MBP and GFAP under untreated (Control) conditions, or following treatment with BMP4, LDN-193189 (LDN), or both BMP4 and LDN-193189 (LDN+BMP4). B, Quantification of cell phenotypic distribution for each condition based on GFAP expression and MBP+ morphology. MBP+ cells were classified as either mature (flattening of branched extracellular membrane) or immature (branched morphology but not fused layers). C, Quantification of the proportion of GFAP+ cells in the cultures. BMP4 significantly increased the proportion of GFAP+ cells compared with untreated (Control) cultures. While LDN-193189 (LDN) alone exerted no significant effect, pretreatment with LDN before BMP4 (LDN+BMP4) significantly abrogated effect of BMP4 on astrocytes. D, Quantification of the proportion of immature oligodendrocytes in the cultures. Treatment with BMP4 or LDN-193189 (LDN) exerted no significant effect, whereas pretreatment with LDN-193189 before BMP4 (LDN+BMP4) significantly increased the proportion of immature oligodendrocytes. E, Quantification of the proportion of mature oligodendrocytes in the cultures. Treatment with BMP4 significantly blocked OPC differentiation, whereas LDN-193189 (LDN) alone exerted no significant effect. Pretreatment with LDN before BMP4 (LDN+BMP4) significantly abrogated the effect of BMP4 on oligodendrocyte differentiation (N = 4 animals/group). ****p < 0.0001. Scale bar, 20 µm.
- Figure 5.
BMP4 signals via BMPR1 in OPCs to promote myelin formation in vitro. A, Representative micrographs of myelinating DRG/OPC cocultures treated with vehicle (control), BMP4, LDN-193189 (LDN), or both LDN-193189 and BMP4 (LDN+BMP4) for 14 d and immunostained for MBP and Neurofilament. Arrows indicate MBP+ myelin segments colabeled with NFL+ axons. B, Quantification of the number of MBP+ myelinated axonal segments per field from these cocultures. BMP4 treatment significantly reduced the number of MBP+ myelin segments compared with cocultures, which is blocked by the pretreatment of LDN-193189 (LDN+BMP4; N = 4 independent cocultures/group). *p < 0.05, ****p < 0.0001. Scale bar, 30 µm.
- Figure 6.
Inhibiting BMP4/BMPRI signaling in OPCs alters the expression of transcription factor Id4 and Gfap, but not Mbp or Myrf. A, B, qRT-PCR analysis of Id4 and Gfap transcript levels from OPCs cultured in differentiation media and treated with LDN-193189, BMP4, or both, or vehicle (control) over various time points. *BMP4 significantly increased the level of Id4 transcripts at 2 and 24 h compared with the control, and this upregulation is blocked by pretreatment with LDN-193189 before BMP4 exposure. *Gfap expression was also significantly reduced by pretreatment of OPCs with LDN-193189 before BMP4 exposure. C, D, qRT-PCR analysis of myelin protein gene Mbp and key myelination transcription factor Myrf from OPCs treated with LDN-193189, BMP4, or both, or vehicle over 24 h. BMP4 significantly reduced the expression level of both Mbp and Myrf genes, with this effect reduced by LDN-193189 pretreatment; N = 3 independent cultures/group). *p < 0.05, **p < 0.01.
- Figure 7.
BMP4 signals via BMPR1A in OPCs to potentiate oligodendrocyte differentiation and reduce astrogliogenesis in vitro. A, Representative micrographs of immunostaining of differentiated OPC cultures (isolated from Pdgfra-CreERT2::Bmpr1a fl/fl mice) for MBP and GFAP under untreated (Control) conditions, or following treatment with BMP4, 4OHT, or both BMP4 and 4OHT (+4OHT+BMP4). B, Quantification of cell-phenotypic distribution for each condition based on GFAP expression and MBP+ morphology, as described above (Fig. 4B). C, Quantification of the proportion of GFAP+ cells in the cultures. BMP4 significantly increased the proportion of GFAP+ cells compared with untreated (Control) cultures, whereas 4OHT alone exerted no significant effect. Pretreatment with 4OHT before BMP4 (+4OHT+BMP4) significantly attenuated the effect of BMP4. D, Quantification of the proportion of immature oligodendrocytes in the cultures. Treatment with BMP4, 4OHT, or both BMP4 and 4OHT (+4OHT+BMP4) exerted no significant effect. E, Quantification of the proportion of mature oligodendrocytes in the cultures. Treatment with BMP4 significantly decreased OPC differentiation, whereas 4OHT alone exerted no significant effect. Pretreatment with 4OHT before BMP4 (+4OHT+BMP4) significantly attenuated the inhibitory effect of BMP4 on OPC differentiation. F, PCR analysis of 4OHT-treated OPCs to assess Bmpr1a knockout. Pdgfra-CreERT2::Bmpr1a fl/fl and Cre[−] OPCs were isolated and treated with 4OHT for 24 h and analyzed for the transcription of a sequence corresponding to Bmpr1a-ex2, rendering the resulting protein untranscribable; N = 4 animals/group). *p < 0.05, ****p < 0.0001. Scale bar, 20 µm.
- Figure 8.
BMP4 signals via BMPR1A in OPCs to promote myelination in vitro. A, Representative micrographs of immunostaining for MBP and Neurofilament (NFL) in myelinating cocultures containing OPCs isolated from Pdgfra-CreERT2::Bmpr1a fl/fl mice. The cocultures were treated with or without 4OHT for 24 h before 14 d of myelination. Arrows indicate MBP+ myelinated axons segments colabeled with NFL+ axons. B, Quantification of MBP+ myelinated axonal segments from these cocultures. 4OHT-induced BMPRIA ablation in OPCs causes significantly more MBP+ myelinated axonal segments compared with controls. C, Western blot analysis of BMPRIA and myelin proteins (MOG and MBP) in sister cocultures from A and B, treated with either 4OHT or vehicle. Treatment with 4OHT substantially reduced BMPRIA expression and leads to qualitatively more myelin proteins (MBP and MOG) expression compared with controls. D, Representative micrographs of immunostaining for MBP and NFL in myelinating cocultures containing OPCs isolated from Bmpr1a fl/fl (Cre− control) mice. The cocultures were treated with or without 4OHT for 24 h before 14 d of myelination. Arrows indicate MBP+ myelin segments colabeled with NFL+ axons. E, Quantification of MBP+ myelinated axonal segments from cocultures. Treatment with 4OHT did not exert a significant effect on myelination in the Cre− cocultures (N = 3 independent cultures/treatment group). **p < 0.01. Scale bar, 30 µm.
Tables
Gene name Forward primer Reverse primer 18S 5´CGAACGTCTGCCCTATCAACTT3´ 5’ACCCGTGGTCACCATGGTA3’ Myelin basic protein (Mbp) 5´CCCGTGGAGCCGTGATC3´ 5´TCTTCAAACGAAAAGGGACGAA-3′ Glial fibrillary acidic protein (Gfap) 5´CGTTTCTCCTTGTCTCGAATGA3´ 5´CCCGGCCAGGGAGAAGT3´ Inhibitor of DNA binding (Id4) 5´TTTGCACGTTCACGAGCATT3´ 5´GCGGTCATAAAAGAAGAAACGAA3´ Myelin regulatory factor (Myrf) 5′AAGGAGCTGCCTATGCTCACCT3′ 5′GCCTCTAGCTTCACACCATGCA3′ BMPRIA (Bmpr1a) 5´TCATGTTCAAGGGCAGAATCTAGA3´ 5´GGCAAGGTATCCTCTGGTGCTA3´ BMPRIB (Bmpr1b) 5´GCGCACCCCGATGTTG3´ 5´CATGTCCCCTAAGAAGCTTTCTG3´ BMPRIA-ex2 5´GTTCATCATTTCTCATGTTCAAACTA3´ 5´AATCAGAGCCTTCATACTTCATACACC3´ Test identifier Type of test Sample size Confidence intervals a0 Student’s unpaired two-tailed t test Three animals per treatment; six technical replicates per animal −11.1 to 37.1 a Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal 14.81–55.60 b Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal −20.02 to −2.95 b1 Student’s unpaired two-tailed t test Four vehicle- and five LDN-treated animals; six technical replicates per animal, approximately 100 axons counted per animal −45.96 to 11.67 b2 Student’s unpaired two-tailed t test Three vehicle- and three LDN-treated animals; six technical replicates per animal, approximately 100 axons counted per animal 0.017–0.091 b3 Two-way ordinary ANOVA with Tukey’s multiple corrections test Three vehicle- and three LDN-treated animals; six technical replicates per animal, approximately 100 axons counted per animal −23.39 to −0.6092 b4 Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal 0.76–123.91 b5 Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal −81.21 to 26.21 c Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal −94.40 to −60.46 d Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal 38.05–91.35 e Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal 4.59–17.66 f Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal −9.19 to −1.36 g Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal −4980.00 to 2499.00 h Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal −33,305.00 to −21,828.00 I Student’s unpaired two-tailed t test Four control and cuprizone-fed animals, six for vehicle- and LDN-treated animals; three technical replicates per animal −7695.00 to 2665.00 j Two-way ordinary ANOVA with Tukey’s multiple corrections test Four independent cultures; three technical replicates per treatment; approximately 500–600 cells counted per treatment −81.20 to −66.60 k Two-way ordinary ANOVA with Tukey’s multiple corrections test Four independent cultures; three technical replicates per treatment; approximately 500–600 cells counted per treatment −68.00 to −53.30 l Two-way ordinary ANOVA with Tukey’s multiple corrections test Four independent cultures; three technical replicates per treatment; approximately 500–600 cells counted per treatment −23.10 to −8.46 m One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; eight 10× image fields counted per treatment group 19.43–51.24 n One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; eight 10× image fields counted per treatment group −51.15 to −19.35 o One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; eight 10× image fields counted per treatment group. −33.99 to −2.18 p One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment −5.49 to −2.99 q One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment −7.02 to −3.91 r One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment 1.11–3.61 s One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment 2.84–5.95 t One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment −2.77 to −0.35 u One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment. −0.17 to 2.25 v One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment −1.36 to −0.16 w One-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment −2.47 to −0.51 x Student’s unpaired two-tailed t test Three independent cultures; three technical replicates per treatment Not available y Two-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment; approximately 500–600 cells counted per treatment −89.42 to −43.00 z Two-way ordinary ANOVA with Tukey’s multiple corrections test Three independent cultures; three technical replicates per treatment; approximately 500–600 cells counted per treatment −32.21 to 14.20 aa Two-way ordinary ANOVA with Tukey’s multiple corrections test Four independent cultures; three technical replicates per treatment; approximately 500–600 cells counted per treatment −23.20 to 23.30 ab Two-way ordinary ANOVA with Tukey’s multiple corrections test Four independent cultures; three technical replicates per treatment; approximately 500–600 cells counted per treatment −19.65 to −2.29 ac Two-way ordinary ANOVA with Tukey’s multiple corrections test Four independent cultures; three technical replicates per treatment; approximately 500–600 cells counted per treatment 13.07–30.42 ad Student’s unpaired two-tailed t test Three independent cultures for both Pdgfra-CreERT2::Bmpr1afl/fl and Bmpr1afl/fl cocultures; eight 10× image fields counted per treatment group 14.65–70.88 ae Student’s unpaired two-tailed t test Three independent cultures for both PdgfraCreERT2::Bmpr1afl/fl and Bmpr1afl/fl cocultures; eight 10x image fields counted per treatment group −39.73 to 36.81 - Table 3:
Summary of differentially regulated BMP/TGF-β signaling pathway genes in OPCs cultured in LDN-193189, BMP4, or both, or vehicle for 24 h in differentiating conditions
Up/down Fold regulation p value BMP4 vs control Gene name Epithelial membrane protein 1 (Emp1) ↑ 9.19 * Noggin (Nog) ↑ 6.20 *** Growth arrest and DNA-damage-inducible 45 β (Gadd45b) ↑ 5.17 * Cyclin-dependent kinase inhibitor 1A (Cdkn1a) ↑ 5.11 ** Transforming growth factor, beta 3 (Tgfb3) ↑ 4.37 * Jun-B oncogene (Junb) ↑ 4.27 * Latent transforming growth factor beta binding protein 1 (Ltbp1) ↑ 3.94 ** BMP and activin membrane-bound inhibitor (Bambi) ↑ 3.84 ** BMP-binding endothelial regulator (Bmper) ↑ 3.40 ** Inhibitor of DNA binding 2 (Id2) ↑ 2.25 * Distal-less homeobox 2 (Dlx2) ↑ 2.10 * TGFβ-1-induced transcript (Tgfb1i1) ↑ 2.06 * Inhibitor of DNA binding 1 (Id1) ↑ 1.94 * FBJ osteosarcoma oncogene (Fos) ↑ 1.94 ** SRY-box containing gene 4 (Sox4) ↑ 1.87 * Small MAD homolog 1 (Smad1) ↑ 1.50 * BMP receptor 1A (Bmpr1a) ↑ 1.54 * Small MAD homolog 5 (Smad5) ↓ −1.27 * Signal transducer and activator of transcription (Stat1) ↓ −1.35 * TGF-β receptor I (Tgfbr1) ↓ −1.60 * Small MAD homolog 2 (Smad2) ↓ −1.66 ** Small MAD homolog 7 (Smad7) ↓ −1.74 * SMAD specific E3 ubiquitin protein ligase 1 (Smurf1) ↓ −2.13 **** Plasminogen activator, urokinase (Plau) ↓ −5.16 ** Bone morphogenetic protein 4 (Bmp4) ↓ −5.53 * LDN-193189 vs controla Gene name Epithelial membrane protein 1 (Emp1) ↓ −2.07 * Inhibitor of DNA binding 2 (Id2) ↓ −3.15 ** BMP-binding endothelial regulator (Bmper) ↓ −3.63 ** Inhibitor of DNA binding 1 (Id1) ↓ −3.65 * Noggin (Nog) ↓ −6.35 * MDS1 and EVI1 complex locus (Mecom) ↓ −22.15 ** LDN-193189+BMP4 vs BMP4b Gene name Bone morphogenetic protein 4 (Bmp4) ↑ 3.32 * TGF-β receptor I (Tgfbr1) ↑ 1.69 * Small MAD homolog 5 (Smad5) ↑ 1.58 * Signal transducer and activator of transcription (Stat1) ↑ 1.41 * Noggin (Nog) ↓ −1.36 * Distal-less homeobox 2 (Dlx2) ↓ −1.40 * FBJ osteosarcoma oncogene (Fos) ↓ −1.42 * Col1a1 ↓ −1.64 * BMP-binding endothelial regulator (Bmper) ↓ −2.12 * BMP and activin membrane-bound inhibitor (Bambi) ↓ −2.22 * Transforming growth factor beta-1-induced transcript 1 (Tgfb1i1) ↓ −2.50 * Cyclin-dependent kinase inhibitor 1A (Cdkn1a) ↓ −3.23 ** Insulin-like growth factor 1 (Igf1) ↓ −3.50 ** Jun-B oncogene (Jun) ↓ −4.19 * Latent transforming growth factor beta binding protein 1 (Ltbp1) ↓ −5.46 *** Epithelial membrane protein 1 (Emp1) ↓ −9.63 *
In this issue
