Article Figures & Data
Figures
- Figure 1.
E2F3 binding at the Fosb gene promoter is regulated in NAc by cocaine. A, E2F consensus sequence and a schematic diagram of Fosb. Primer sets designed against putative E2F binding sites noted with golden double arrowheads. B, E2F3 binding, not E2F1 or E2F4, was increased following cocaine administration 500 bp upstream of the Fosb TSS (interaction of drug and gene position was observed by two-way ANOVA: F(9,60) = 13.35, p < 0.0001; Cocaine vs saline at −500 bp via post hoc analysis: t(8) = 9.904, ****p < 0.0001). All data points have error bars representing ± SEM. C–F, Significant binding of E2F3 over an IgG control was observed and significantly increased by cocaine in (C) NAc (F(9,60) = 13.35, ****p < 0.0001, t(8) = 9.904, ****p < 0.0001). Significant binding of E2F3 was observed but was not affected by cocaine administration in (D) PFC, binding over an IgG control (F(1,16) = 48.44, ****p < 0.0001), no main effect of drug observed (F(1,16) = 1.789, p = 0.1998); (E) VTA, binding over an IgG control (F(1,10) = 7.024, *p = 0.0243), no main effect of drug observed (F(1,10) = 0.029, p = 0.869); or (F) CPu, binding over an IgG control (F(1,16) = 25.113, ****p < 0.0001), no main effect of drug observed (F(1,16) = 1.12, p = 0.305). N = 4–5, with three mice pooled per sample for all qChIP assays.
- Figure 2.
E2F3a is expressed in NAc D1 MSNs and overexpression of E2F3a in NAc regulates expression of Fosb isoforms in NAc. A, Expression of E2f3a and E2f3b in FACS-isolated D1 MSNs. Main effects of both drug treatment (F(1,9) = 9.624, p = 0.0127) and transcript variant (F(1,9) = 6.845,*p = 0.028) were observed. A significant increase in E2f3a expression was confirmed via post hoc analysis (E2f3a: t(5) = 4.186, **p = 0.0047; E2f3b: t(4) = 0.3328, p = 0.9999). N = 3–4. B, Expression of E2f3a and E2f3b in FACS-isolated D2 MSNs. A main effect of transcript was observed (F(1,9) = 15.489, **p = 0.0034) but no effect of drug treatment (F(1,9) = 0.0171, p = 0.8987). N = 3–4. C, NAc cross section indicating site of injection for viral-mediated gene transfer. D, qPCR from mouse NAc injected with HSV-GFP, HSV-E2F3a, or HSV-E2F3b. Normalized to GFP (Gapdh used as housekeeping gene in ΔΔCt method). A main effect of virus was observed (F(2,29) = 9.332, p = 0.0007). E2F3a, but not E2F3b, increased both Fosb and ΔFosb mRNA expression by post hoc analysis (E2F3a vs GFP–Fosb: t(10) = 3.138, **p = 0.0117; E2F3a vs GFP–ΔFosb: t(9) = 2.868, *p = 0.0229; E2F3b vs GFP–Fosb: t(10) = 1.336, p = 0.5757; E2F3b vs GFP–ΔFosb: t(10) = 0.575, p = 0.9999; N = 8). E, qPCR from mouse PFC injected with HSV-GFP or HSV-E2F3a. Normalized to GFP. No main effect of virus was observed (F(1,19) = 1.637, p = 0.2162; N = 6). F, qPCR from mouse NAc injected with HSV-miR-LacZ or HSV-miR-E2F3a and treated with either saline or acute cocaine (1 injection of 20 mg/kg). Normalized to miR-LacZ + saline. A main effect of drug treatment was observed (F(3,20) = 3.297, p = 0.0415) and post hoc analysis confirmed that acute cocaine increased ΔFosb expression and viral knockdown of E2F3a did not significantly blunt this effect (miR-LacZ + saline vs miR-LacZ + cocaine: t(9) = 2.492, *p = 0.0508, miR-LacZ + saline vs miR-E2f3a + cocaine: t(9) = 1.223, p = 0.9999; miR-LacZ + cocaine vs miR-E2f3a + cocaine: t(10) = 1.331, p = 0.9999; N = 5–7).
- Figure 3.
Viral-mediated E2F3a overexpression leads to increased E2F3 binding at Fosb promoter in NAc. A, E2F3 binding was increased at 500 bp upstream of the Fosb TSS after E2F3a overexpression (interaction of virus and gene position by two-way ANOVA: F(3,35) = 3.619, p = 0.0224; E2F3a vs GFP at −500 bp via post hoc analysis: t(7) = 3.285, **p = 0.0093). B, H3K4me3 enrichment was not affected by E2F3a overexpression (no main effect of virus observed: F(1,40) = 0.057, p = 0.8126). N = 5–6, with three mice pooled per sample for all qChIP assays.
Tables
Location on Fosb Forward Reverse −1250 ATGGGACTCAGGTTGTCAGG AGCCAGGGCTACACAGAGAA −500 GAGTTGCACCTTCTCCAACC GGCCCAGTGTTTGTTTGGTA −250 ATGGCTAATTGCGTCACAGG ACCTCCCAAACTCTCCCTTC Exon IV CAACCTGACGGCTTCTCTCT CGGGTTTGTTTGTTTTGTTTG These qChIP primers were used to amplify three putative E2F consensus sequences in Fosb: 500 and 250 bp upstream of the TSS, and a site within Exon IV. A sequence 1250 bp upstream of the TSS was used as a negative control.
Transcript Forward Reverse Fosb GTGAGAGATTTGCCAGGGTC AGAGAGAAGCCGTCAGGTTG ΔFosb AGGCAGAGCTGGAGTCGGAGAT GCCGAGGACTTGAACTTCACTCG Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA These qPCR primers were used to amplify and assess expression of Fosb and ΔFosb mRNA. Gapdh was used as a housekeeping gene in the ΔΔCt method.
Figure Data structure Type of test Power a Fig. 1B,C Normal distribution 4 × 4 ANOVA 0.0621 b Fig. 1D Normal distribution 2 ×2 ANOVA 0.0595 c Fig. 1E Normal distribution 2 ×2 ANOVA 0.0595 d Fig. 1F Normal distribution 2 ×2 ANOVA 0.0595 e Fig. 2A Normal distribution 2 ×2 ANOVA 0.0558 f Fig. 2B Normal distribution 2 ×2 ANOVA 0.0558 g Fig. 2D Normal distribution 2 ×3 ANOVA 0.0692 h ΔFosb/Fosb mRNA ratio Normal distribution Student’s t test 0.0661 i Fig. 2E Normal distribution 2 ×2 ANOVA 0.0607 j Fig. 2F Normal distribution 2 ×4 ANOVA 0.0651 k Fig. 3A Normal distribution 2 ×2 ANOVA 0.0607 l Fig. 3B Normal distribution 2 ×2 ANOVA 0.0607
In this issue
