Article Figures & Data
Figures
- Figure 1.
EAE-induced complement and inflammasome activation in the DRG. A–C, PCR analysis of lumbar DRGs from EAE animals revealed that the complement component 3 (C3), its receptor C3aR1, and component 5a receptor (C5aR1; also known as CD88) are transiently upregulated at the onset of disease as compared to CFA control samples. D, Similarly, mRNA transcripts of NLRP3, caspase-1, IL-1β, and IL-18 are also upregulated at disease onset only to taper off at the chronic time point 21 d post-induction. NLRP3 = NACHT, LRR, and PYD domains-containing protein 3; IL = interleukin. Bars indicate mean ± SEM; *,#p < 0.05; **,##p < 0.01; ***,###p < 0.001, one-way ANOVAs with Tukey’s post hoc analysis. CFA, n = 5; onset, n = 5; chronic, n = 5.
- Figure 2.
Immune cells infiltrate the DRG in EAE. A–C, IHC analysis further confirmed that C5aR1+ immune cells, CD4+ T-cells, and Iba1+ macrophages infiltrate the DRG at EAE onset and retreat at the later, chronic disease stage. C5aR1 = complement 5a receptor; CD4 = cluster of differentiation 4; Iba1 = ionized calcium binding adapter molecule 1. Bars indicate mean ± SEM; *p < 0.05, **p < 0.01, ***p < 0.001, one-way ANOVAs with Tukey’s post hoc analysis. CFA, n = 5; onset, n = 5; chronic, n = 5.
- Figure 3.
Myelin protein transcripts in the periphery are not significantly altered in EAE. A–F, mRNA transcripts of MBP, PMP22, and MPZ were not significantly altered in EAE. G–I, MBP, PMP22, and MOG transcripts were reduced at EAE onset in the dSC suggesting myelinopathy. Normalization of these transcripts was also observed chronically which may indicate repair mechanisms; *,#p < 0.05, one-way ANOVAs with Tukey’s post hoc analysis. A–C, CFA, n = 4; onset, n = 3; chronic, n = 3. D–I, CFA, n = 5; onset, n = 5; chronic, n = 5.
- Figure 4.
Cellular injury marker, ATF3, is upregulated in the DRG of EAE animals. A–C, ATF3 expression in the nucleus of DRG neurons is induced with the onset of disease signs. P-NFH staining is used to identify neurons. C, The number of ATF3-positive neurons in the DRG were normalized to the area (in pixels) of the entire DRG. Bars indicate mean ± SEM; **p < 0.01, two-tailed unpaired t test with Welch’s correction. CFA, n = 5; EAE, n = 13.
- Figure 5.
Cytoskeletal disruption of DRG neurons occurs late in the EAE disease course. A–F, Western blotting data suggest that cytoskeletal proteins remain intact at the onset of EAE symptoms and become impaired at the chronic time point. We observe a significant elevation in the level of the non-phosphorylated isoform of heavy-chain NFH at the chronic stage. On the contrary, a significant reduction in the levels of tau, kinesin, α-tubulin, and β-actin was detected chronically. G, H, Immunofluorescence staining of lumbar DRGs for the p-NFH revealed a significant reduction in fluorescence intensity in chronic samples (20.23 ± 1.976 a.u.) as compared to CFA control (29.26 ± 1.951 a.u.) and EAE onset samples (28.68 ± 1.581 a.u.). Furthermore, p-NFH staining in the soma of chronic DRG neurons displays aberrant morphology. a.u. = arbitrary units. Bars indicate mean ± SEM. O = onset; C = chronic; *,#p < 0.05, one-way ANOVAs with Tukey’s post hoc analysis. A–F, CFA, n = 5; onset, n = 4; chronic, n = 4. G, H, CFA, n = 4; onset, n = 6; chronic, n = 6.
- Figure 6.
Larger diameter (≥26 µm) dissociated DRG neurons exhibit hyperexcitability. A, B, Labeling DRG sections from non-diseased control mice with p-NFH (also known as NF200) demonstrates that 90% of p-NFH+ cells are ≥26 µm, delineating smaller and larger cells. C, D, Dissociated DRG neurons from these animals exhibit aberrant firing properties under current ramp analysis. In particular, larger diameter (≥26 µm) EAE sensory neurons at disease onset have reduced rheobase and fire more APs with a current ramp of 1.5 and 2.0 nA than their CFA counterparts. EAE chronic DRG neurons also exhibit increased firing pattern at a current ramp of 2.0 nA but show an insignificant reduction in their rheobase. E, Sample 2.0-nA current ramp traces of dissociated DRG neurons. F–H, Half width of smaller diameter neurons (<26 µm) as well as cumulative latencies of APs remain relatively unchanged with EAE disease. I–K, Although spike width is unaffected in larger diameter neurons (≥26 µm), cumulative latencies are reduced with EAE disease indicating that APs fire quicker in succession with the onset of EAE. Other spike parameters are summarized in Table 3. C, *,#p < 0.05, Kruskal–Wallis H test. * CFA versus Onset; # CFA versus Chronic. D, **p < 0.01, one-way ANOVAs with Tukey’s post hoc analysis. K, *,#p < 0.05, two-way ANOVA with Tukey’s post hoc analysis. A, B, n = 5, 674 of 1055 cells were p-NFH+. C, D, <26 µm: CFA, n = 33; onset, n = 17; chronic, n = 27; ≥26 µm: CFA, n = 76; onset, n = 51; chronic, n = 94. G, CFA, n = 24; onset, n = 13; chronic, n = 27. H, CFA, n = 31; onset, n = 17; chronic, n = 25. J, CFA, n = 76; onset, n = 52; chronic, n = 94. K, CFA, n = 40; onset, n = 27; chronic, n = 44.
Tables
Gene ID FWD/REV Sequence (5’–3’) Ppia FWD GAGCTGTTTGCAGACAAAGTTC REV CCCTGGCACATGAATCCTGG C3 FWD GAGGCACATTGTCGGTGGTG REV CCAGGATGGACATAGTGGCG C3ar1 FWD CTCAGCAACTCGTCCAATGC REV CCATGGCTCAGTCAAGCACA C5ar1 FWD CTTCCTTCAGAAGAGTTGCCTG REV AGCTGCTGTTATCTATGGGGTC Nlrp3 FWD ATTACCCGCCCGAGAAAGG REV TCGCAGCAAAGATCCACACAG Casp1 FWD ACAAGGCACGGGACCTATG REV TCCCAGTCAGTCCTGGAAATG Il1b FWD GCAACTGTTCCTGAACTCAACT REV ATCTTTTGGGGTCCGTCAACT Il18 FWD ACTTTGGCCGACTTCACTGT REV GGGTTCACTGGCACTTTGAT Mbp N/A QIAGEN, PPM04745F Pmp22 N/A QIAGEN, PPM05053F Mpz N/A QIAGEN, PPM41824A Mog N/A QIAGEN, PPM33328B Antibody Host Source Dilution factor CD4 Rt Bio-Rad, MCA2691 1:200 CD88 (C5aR1) Rt Bio-Rad, MCA2456GA 1:500 IBA-1 Rb Wako, 019-19741 1:500 p-NFH (IHC) Ck ThermoFisher, PA1-10002 1:5000 ATF3 (IHC) Rb Santa Cruz, SC-188 1:200 NFH (WB) Ms Covance, 14974402 1:1000 Tau Rb Abcam, ab64193 1:200 Kinesin Ms Millipore, MAB1614 1:500 α-Tubulin Rb Cell Signalling, 2125 1:1000 β-Actin Ms Sigma, A1978 1:2000 Goat anti-mouse IgG HRP Gt Abcam, ab6789 1:10,000 Goat anti-rabbit IgG HRP Gt Abcam, ab6721 1:10,000 Goat anti-rabbit IgG AF488 Gt Life Technologies, A11008 1:200 Goat anti-chicken IgY AF594 Gt Life Technologies, A11042 1:200 Goat anti-rat IgG AF488 Gt Life Technologies, A11006 1:200 - Table 3.
Various spike parameters of small (<26 µm) and large (≥26 µm) diameter DRG neurons obtained from CFA, EAE onset, and EAE chronic mice
<26 µm ≥26 µm Spike parameter CFA Onset Chronic CFA Onset Chronic Peak amplitude (mV) 116.4 ± 2.159 112.5 ± 2.437 116.2 ± 2.42 104.9 ± 1.796 102.2 ± 2.066 108.9 ± 1.362# Afterhyperpolarization Amplitude (mV) –14.38 ± 0.927 –10.22 ± 1.223** –13.65 ± 0.525# –13.84 ± 0.598 –12.18 ± 0.657 –12.38 ± 0.483 Half width (ms)& 3.959 ± 0.421 5.165 ± 0.915 4.213 ± 0.348 1.18 ± 0.104 1.474 ± 0.141 1.233 ± 0.083 Rise slope (mV/ms) 175.3 ± 22.55 83.64 ± 6.219** 143.1 ± 10.36## 236.7 ± 14.12 108.5 ± 4.298*** 218.8 ± 12.5### Decay slope (mV/ms) –62.46 ± 6.376 –45.32 ± 8.131 –55.19 ± 5.451 –134.4 ± 5.835 –96.5 ± 5.518*** –120.4 ± 4.876# Rheobase (nA)& 0.2625 ± 0.017 0.3 ± 0.023 0.3074 ± 0.018 0.4697 ± 0.028 0.349 ± 0.027** 0.4138 ± 0.022 Mean ± SEM. One-way ANOVA followed by Tukey’s test performed within each group; *p < 0.05, **p < 0.01, ***p < 0.001, in comparison to CFA; #p < 0.05, ##p < 0.01, ###p < 0.001 in comparison to Onset. &Graphed in Figure 6.
Figure Data structure Statistical test Sample size Statistical data 1 Log2-transformed to normalize data One-way ANOVA
(Tukey’s post hoc test)CFA: 5
Onset: 5
Chronic: 5A: F(2,12) = 17.78, p = 0.0003
B: F(2,12) = 4.217, p = 0.0410
C: F(2,12) = 8.126, p = 0.0059
Di: F(2,12) = 34.37, p < 0.0001
Dii: F(2,12) = 42.74, p < 0.0001
Diii: F(2,12) = 42.83, p < 0.0001
Div: F(2,12) = 9.410, p = 0.00352A Normal One-way ANOVA
(Tukey’s post hoc test)CFA: 4
Onset: 5
Chronic: 5F(2,11) = 17.51, p = 0.0004 2B Normal One-way ANOVA
(Tukey’s post hoc test)CFA: 5
Onset: 5
Chronic: 3F(2,10) = 6.254, p = 0.0173 2C Normal One-way ANOVA
(Tukey’s post hoc test)CFA: 4
Onset: 5
Chronic: 4F(2,10) = 6.361, p = 0.0165 3A–C Log2-transformed to normalize data One-way ANOVA
(Tukey’s post hoc test)CFA: 4
Onset: 3
Chronic: 3A: F(2,7) = 0.9470, p = 0.4325
B: F(2,7) = 2.747, p = 0.1317
C: F(2,7) = 0.9616, p = 0.42763D–I Log2-transformed to normalize data One-way ANOVA
(Tukey’s post hoc test)CFA: 5
Onset: 5
Chronic: 5D: F(2,12) = 0.7474, p = 0.4944
E: F(2,12) = 1.770, p = 0.2120
F: F(2,12) = 0.8078, p = 0.4687
G: F(2,12) = 10.52, p = 0.0023
H: F(2,12) = 9.242, p = 0.0037
I: F(2,12) = 12.56, p = 0.00114C Non-normal Two-tailed unpaired t test with Welch’s correction CFA: 5
EAE: 13t(12.41) = 3.237, p = 0.0069 5A–E Log2-transformed to normalize data One-way ANOVA
(Tukey’s post hoc test)CFA: 5
Onset: 4
Chronic: 4A: F(2,10) = 10.73, p = 0.0032
B: F(2,10) = 29.40, p < 0.0001
C: F(2,10) = 4.361, p = 0.0435
D: F(2,10) = 25.80, p = 0.0001
E: F(2,10) = 15.92, p = 0.00115H Normal One-way ANOVA
(Tukey’s post hoc test)CFA: 4
Onset: 6
Chronic: 6F(2,13) = 7.750, p = 0.0061 6C Non-parametric Kruskal–Wallis H test <26 µm:
CFA: 33
Onset: 17
Chronic: 27
≥26 µm:
CFA: 76
Onset: 51
Chronic: 94<26 µm:
H0.5nA(2) = 0.3138, p = 0.8548
H1.0nA(2) = 0.1677, p = 0.9196
H1.5nA(2) = 0.8715, p = 0.2750
H2.0nA(2) = 0.9634, p = 0.6177
≥26 µm:
H0.5nA(2) = 1.498, p = 0.4728
H1.0nA(2) = 3.924, p = 0.1406
H1.5nA(2) = 7.448, p = 0.0241
H2.0nA(2) = 9.943, p = 0.00696D Normal One-way ANOVA
(Tukey’s post hoc test)<26 µm:
CFA: 24
Onset: 13
Chronic: 27
≥26 µm:
CFA: 76
Onset: 51
Chronic: 94F<26µm(2,61) = 1.849, p = 0.1660
F≥26µm(2,219) = 5.274, p = 0.00586G Normal One-way ANOVA
(Tukey’s post hoc test)CFA: 24
Onset: 13
Chronic: 27F(2,61) = 1.238, p = 0.2971 6H Normal Two-way ANOVA (Tukey’s post hoc test) CFA: 31
Onset: 17
Chronic: 25Disease: F(2,444) = 2.740, p = 0.0657
Spike number: F(7,444) = 25.00, p < 0.0001
Interaction: F(14,444) = 0.1811, p = 0.99966J Normal One-way ANOVA
(Tukey’s post hoc test)CFA: 76
Onset: 52
Chronic: 94F(2,219) = 1.832, p = 0.1625 6K Normal Two-way ANOVA (Tukey’s post hoc test) CFA: 40
Onset: 27
Chronic: 44Disease: F(2,708) = 38.03, p < 0.0001
Spike number: F(7,708) = 11.82, p < 0.0001
Interaction: F(14,708) = 0.6171, p = 0.8522Table 3 Normal and non-normal One-way ANOVA
(Tukey’s post hoc test) or Kruskal–Wallis H test<26 µm:
CFA: 24
Onset: 13
Chronic: 27
≥26 µm:
CFA: 76
Onset: 51
Chronic: 94Peak amplitude:
F<26µm(2,61) = 0.6022, p = 0.5508
F≥26µm(2,219) = 3.883, p = 0.0220
Afterhyperpolarization amplitude:
F<26µm(2,61) = 5.211, p = 0.0081
F≥26µm(2,219) = 2.481, p = 0.0860
Half width (as plotted in Fig. 6):
F<26µm(2,61) = 1.238, p = 0.2971
F≥26µm(2,219) = 1.832, p = 0.1625
Rise slope:
H<26µm(2) = 14.44, p = 0.0007
H≥26µm(2) = 50.99, p < 0.0001
Decay slope:
F<26µm(2,61) = 1.423, p = 0.2488
F≥26µm(2,219) = 10.08, p < 0.0001
Rheobase (as plotted in Fig. 6):
F<26µm(2,61) = 1.849, p = 0.1660
F≥26µm(2,219) = 5.274, p = 0.0058
In this issue
