PICK1-Deficient Mice Exhibit Impaired Response to Cocaine and Dysregulated Dopamine Homeostasis

Subjects

Male PICK1 KO mice (Gardner et al., 2005), DAT + Ala knock-in mice (Rickhag et al., 2013) and wild-type littermates of at least 10 weeks of age at the beginning of an experiment were used, unless otherwise specified. Mice were group-housed in a temperature-controlled room maintained on a 12/12 h light/dark cycle (lights on at 7 A.M.) with access to standard rodent chow and water ad libitum. Animals were allowed to habituate to the facility for at least 7 d before initiation of experiments. Animal experiments were performed in accordance with the guidelines of the Danish Animal Experimentation Inspectorate (permission number 2012-15-293-00279 and 2012-15-2934-00038) in a fully AAALAC (American Association for Laboratory Animal Care)-accredited facility under the supervision of a local animal welfare committee. Chronoamperometric experiments conducted at University of Texas Health Science Center at San Antonio were performed in accordance with Institutional Animal Care and Use Committee approved protocols, in a fully AAALAC-accredited facility. All efforts were made to minimize pain and discomfort as well as the number of animals used during the experiments.

Drugs

SKF82958 hydrobromide and quinpirole hydrochloride was purchased from Sigma-Aldrich. Cocaine hydrochloride was obtained from the Copenhagen University Hospital Pharmacy. All drugs were prepared in 0.9% aqueous NaCl, with a final pH 6–7 and injected intraperitoneally in a volume of 10 ml/kg.

Drug-induced hyperlocomotion without habituation

Locomotor activity was measured in activity boxes as previously described (Sørensen et al., 2012; Rickhag et al., 2013). Mice (wild-type/PICK1 KO/DAT + Ala mice) were injected with either 0-, 5-, 10-, or 30-mg/kg cocaine dissolved in saline intraperitoneally 3–7 min before testing. The animals were then placed in a cage and the activity was measured for 1 h. Each mouse only received one dose of cocaine and cages were cleaned between tests.

Drug-induced hyperlocomotion with habituation

PICK1 KO and wild-type mice were habituated to the experimental room for a minimum of 30 min before the experiment. The mice were placed in the open field (40 × 40 × 80 cm) for a 120-min habituation period followed by intraperitoneal administration of the DA D1 receptor (D₁R) agonist, SKF82958 (0.3 or 1 mg/kg), cocaine (10 or 30 mg/kg), DA D2 receptor (D₂R) agonist, quinpirole (0.1 or 10 mg/kg), or vehicle. With a minimum 7-d washout period, mice were retested in a counterbalanced Latin-square design so that each animal only received the same drug once. A video camera placed above the open field recorded the animals’ behavior and the distance traveled by the animal was analyzed using the video-tracking software EthoVision (Noldus). For best possible comparison to the effect of cocaine on the unhabituated mice, locomotion was analyzed for the 60 min before and after drug injection (injection at t = 120).

Cocaine-induced locomotor sensitization

After administration of saline on the initial day (day 0), PICK1 KO and wild-type mice were divided into two groups that received either cocaine (10 mg/kg, i.p.) or saline for 6 d (day 1–6). All mice were given cocaine (10 mg/kg, i.p.) on day 12 and day 20 and retested in the open field. On day 21, all mice were injected with saline and re-exposed to the open field to examine whether context conditioning had any effect on the observed response. Mice spent 60 min in the open field box on all testing days, and locomotion was recorded and analyzed using EthoVision (Noldus).

Intravenous self-administration of cocaine or liquid food

Equipment, training, and evaluation procedures were performed as previously described for chronic self-administration of cocaine or liquid food (Schmidt et al., 2011; Sørensen et al., 2015).

Cocaine (1.0 mg/kg per infusion) was available under a fixed ratio 1:1 (FR1) schedule in daily 3-h sessions, 5–6 d per week, until baseline criteria was met (≥20 reinforcers earned, with ≤20% variation over two consecutive sessions and ≥70% responses in the active hole). In consecutive sessions, saline was substituted for cocaine until extinction criteria were met (<80% of the baseline responding for cocaine self-administration). This was followed by reintroduction of the training dose until previously established baseline criteria were met again or a new baseline was established with similar requirements as above. Subsequently, dose-effect functions (saline, 0.03, 0.1, 0.3, 1.0 mg/kg per infusion of cocaine) were determined for each mouse according to a Latin-square design twice in each mouse. To prevent overdosing, total drug intake was limited to 30 mg/kg per session.

Another set of experimentally naïve mice was used for self-administration of a nondrug reinforcer under a FR1 schedule. The mice were food deprived for 18–20 h (with ad libitum water) before the first presentation of liquid food (5 ml of Nutridrink, vanilla flavor, Nutricia) in the operant chamber. When ≥1.5 ml of the 5 ml available was consumed per 2-h session, mice were placed in the operant chamber with one active and one inactive nose-poke hole for daily 2-h sessions similar to cocaine FR1 self-administration. Acquisition lasted until criteria were met (≥20 reinforcers earned, with ≤20% variation over two consecutive sessions and ≥70% responses in the active hole). Subsequently, water was substituted until responding was extinguished to <80% of food-maintained responding. This was followed by reintroduction of the training concentration of liquid food until previously established baseline criteria were met again or a new baseline was established with similar requirements as above. Then, a range of liquid food dilutions (Nutridrink: water; 3%, 10%, 32%, and 100%) was presented according to a Latin-square design, determined twice in each mouse.

Immunoblotting

Equal amounts of samples, prepared as described in the following sections, were run on a 10/15 well any kDa, prestacked gel (Bio-Rad) and transferred to PVDF membranes (Millipore). Membranes were blocked in either 5% bovine serum albumin in 0.05% PBS/Tween 20 or 2% PVP-40 in 0.05% PBS/Tween 20 (phospho-proteins) or in 5% dry milk in 0.05% PBS/Tween 20 (unphoshorylated proteins), and incubated overnight with antibodies against flotillin (1:1000, SAB2500404, rabbit polyclonal, Sigma), DAT (1:1000, MAB369, rat monoclonal, Millipore), D₁R (1:1000, D2944, rat polyclonal, Sigma), TH (1:1000, MAB318, mouse monoclonal, Millipore), phospho-TH (1:1000, 2791S, rabbit polyclonal, Cell Signaling), cAMP response element binding protein (CREB; 1:1000, 48H2, rabbit polyclonal, Cell Signaling), anti-phospho-Ser133 CREB (1:1000, p1010-133, PhospoSolutions), or vesicular monoamine transporter-2 (VMAT2; 1:1000, Ab191121, rabbit polyclonal, Abcam) depending on the experiment. Following incubation with horseradish peroxidase (HRP)-conjugated anti-rabbit/anti-mouse/anti-rat antibodies (1:2000), the blots were visualized by chemiluminescence (ECL kit, GE Healthcare for un-phosphorylated proteins and SuperSignal ELISA Femto Maximum Sensitivity Substrate, Thermo Scientific for phosphorylated proteins) using AlphaEase (Alpha Innotech). To verify equal protein loading, the membranes were probed with antibodies against Na⁺/K⁺ ATPase (1:1000, Ab7671, mouse monoclonal, Abcam) or HRP-conjugated β-actin (1:10000, A3854, mouse monoclonal, Sigma). In surface biotinylation experiments, band intensities of biotinylated DAT and D₁R were normalized to the band intensity of total DAT and D₁R in the respective input lysates.

Preparation of striatal lysates for surface biotinylation experiments

Surface biotinylation was performed as previously described (Runegaard et al., 2017).

Preparation of striatal and midbrain lysates for immunoblotting

Adult mice were killed by decapitation and brains rapidly removed. Striatum and midbrain were rapidly dissected and homogenized in RIPA lysis buffer (1% Triton X-100, 1 mM EGTA, 1 mM EDTA, 150 mM NaCl, 1% NP-40, 10 mM TRIS-HCl; pH 7.4) supplemented with protease inhibitor cocktail (Roche Diagnostics) and phosphatase inhibitor cocktail 3 (Sigma Aldrich). Tissue was incubated on ice for 20 min followed by centrifugation at 16,000 × g for 20 min at 4°C. Supernatant was transferred to new tubes and an aliquot was removed to determine protein concentration using a BCA Protein Assay kit (Pierce). Samples were eluted in SDS loading buffer and left at 37°C for 30 min followed by immunoblotting.

Preparation of striatal lysates for sucrose gradient centrifugation experiments

Adult mice were killed by decapitation and brains rapidly removed. Striatum from PICK1 wild-type and KO mice were rapidly dissected and homogenized in homogenization buffer (0.32 M sucrose and 4 mM HEPES; pH 7.4). Samples were centrifuged at 1000 × g for 10 min at 4°C to remove cell nuclei followed by centrifugation at 16,000 × g for 20 min at 4°C to pellet the membranes. The pellet was homogenized in 1-ml lysis buffer [1% Brij56 (w/V)], protease inhibitor, and 0.2 mM PMSF in the gradient buffer (25 mM HEPES and 150 mM NaCl; pH 7.4) for 15 min on ice. A 1-ml sample was mixed with 1-ml sucrose (80% w/V) in gradient buffer to create 2 ml with final 40% (w/V) sucrose content in a 15-ml centrifuge tube (Beckman Coulter). On top of this, a 12 ml 35–15% continuous gradient was assembled using a SG15 gradient maker (Hoefer). Subsequently the gradient was ultracentrifuged at 100,000 × g for 18 h in a Beckman SW28.1 rotor head (Beckman Coulter) and fractionated into nine fractions using a P1 pump. Each fraction was incubated for 30 min at 37°C in SDS loading buffer with a final concentration of 66 mM DTT followed by immunoblotting.

Preparation of striatal and midbrain lysates for coimmunoprecipitation experiments

Adult male C57BL/6 mice (age, two to three months) were killed and brains immediately placed in ice-cold artificial CSF (aCSF; 124 mM NaCl, 3 mM KCl, 26 mM NaHCO₃, 1.25 mM NaH₂PO₄, 2 mM CaCl₂, 1 mM MgSO₄, and 10 mM D-glucose) while striatum and midbrain were dissected. Tissue was homogenized in lysis buffer [50 mM Tris (pH 7.4), 150 mM NaCl, 0.1% SDS, 0.5% Na deoxycholate, 1% Triton X-100, 5 mM NaF, and 1× Roche protease inhibitor cocktail]. Lysates were centrifuged at 20,000 × g for 15 min and supernatants precleared with streptavidin beads (Dynabeads MyOne Streptavidin T1, Thermo). A total of 500-μg protein lysate was incubated with 5-μg TH/PICK1 Ab (TH, MAB318 Millipore; PICK1 rabbit, a kind gift from Dr. Richard Huganir, Johns Hopkins University, Baltimore, MD) and incubated at 4°C, rotating overnight. Protein-G beads were added and samples left for an additional 3 h. Beads were washed in lysis buffer and proteins were eluted in SDS loading buffer and left at 100°C for 6 min followed by immunoblotting.

Striatal DA uptake

Synaptosomal uptake assay was performed as described previously (Jensen et al., 2017; Runegaard et al., 2017).

HPLC determination of striatal DA content

HPLC analysis was performed as described previously (Jensen et al., 2017).

In vivo high-speed chronoamperometry

In vivo high-speed chronoamperometry was conducted using the FAST-12 system (Quanteon; http://www.quanteon.cc) as previously described (Owens et al., 2005; Williams et al., 2007; Daws et al., 2016) with some modification. Recording electrode/micropipette assemblies were constructed using a single carbon-fiber (30 μm in diameter; Specialty Materials), which was sealed inside fused silica tubing (SCHOTT North America). The exposed tip of the carbon fiber (150 μm in length) was coated with 5% Nafion (Aldrich Chemical Co; three to four coats baked at 200°C for 5 min per coat) to provide a 1000-fold selectivity of DA over its metabolite 3,4-dihydroxyphenylacetic acid (DOPAC). Under these conditions, microelectrodes display linear amperometric responses to 0.25–10 μM DA during in vitro calibration in 100 mM PBS (pH 7.4).

Male wild-type or PICK1 KO mice weighing 26–36 g were anesthetized by intraperitoneal injection (10-ml/kg body weight) of a mixture of urethane (70 mg/ml) and α-chloralose (7 mg/ml), then fitted with an endotracheal tube to facilitate breathing, and placed into a stereotaxic frame (David Kopf Instruments). Body temperature was maintained by placing the animals on a water-circulated heating pad. To locally deliver potassium chloride (KCl; 200 µM, Sigma, pH 7.4) close to the recording site, a glass multi-barrel micropipette (FHC) was positioned adjacent to the microelectrode using sticky wax (Moyco). The center-to-center distance between the microelectrode and the micropipette ejector was ∼200 μm. The electrode/micropipette assembly was lowered into the striatum at the following coordinates (in mm from bregma; Franklin, 1997): A/P, +1.1; M/L, ±1.4; and D/V, −2.25. To evoke release of endogenous DA, KCl was pressure-ejected using a Picospritzer II (General Valve Corporation) in an ejection volume 43 ± 7 nl, 8.5 ± 1 pmol and 41 ± 6 nl, 8.0 ± 1 pmol, for wild type and KO, respectively. To record KCl-evoked efflux of DA at the carbon fiber electrode, oxidation potentials consisting of 100-ms pulses of 550 mV, each separated by a 900-ms interval, during which the resting potential was maintained at 0 mV, were applied with respect to an Ag/AgCl reference electrode implanted into the contralateral superficial cortex. Oxidation and reduction currents were digitally integrated during the last 80 ms of each 100-ms voltage pulse. For each recording session, DA was identified by its reduction/oxidation current ratio, which ranged from 0.50 to 0.83. Detailed methods can be found in Daws et al. (2016). Peak signal amplitude was used as an index of striatal tissue pools of DA. At the conclusion of each experiment, an electrolytic lesion was made to mark the placement of the recording electrode tip. Mice were then decapitated while still anesthetized, and their brains were removed, frozen on dry ice, and stored at −80°C until sectioned (20 μm) for histologic verification of electrode location within the striatum.

Isolation and mRNA expression analysis

Adult mice were killed by decapitation and brains rapidly removed. Midbrain from PICK1 wild-type and KO mice was rapidly dissected in the presence of RNase away (Molecular Bioproducts, Fischer scientific). Samples were collected on dry ice and placed at -80˚C until RNA extraction. Samples were lyzed using a QIAGEN microRNA column (QIAGEN) according to the manufacturer’s instructions, including DNase treatment. Conversion from RNA to cDNA was done with SuperScript III (Thermo Fisher). Reaction 1 (70°C for 5 min): max 1-µg RNA, 50-ng random primer, 0.2 µmol DTT, H₂O to a final volume 15 µl. Reaction 2 (10 min at 25°C, 50 min at 50°C, and 5 min at 80°C): 10× reverse transcription buffer, 10 nmol dNTP mix, 40-U RNaseOUT, 200-U superscript, H₂O to a final volume of 5 µl, thereafter added to reaction 1. Before running qPCR on the samples, cDNA was diluted 10× with sterile water. The Agilent Mx3000p (Agilent Technologies) real-time thermocycler was used to perform the qPCR using SYBR green (PrecisionPLus 2× qPCR Mastermix Primer design Ltd.) as probe. Data collection was performed by MxPro software and analyzed in Microsoft Excel as well as GraphPad Prism version 6. All samples were run in duplicates and β-actin was used as reference/housekeeping gene. Relative expression was calculated through the ΔΔC_q method (Pfaffl, 2001). Primers for β-actin forward: TTCTACAATGAGCTGCGTGTG and reverse: GGGGTGTTGAAGGTCTCAAA; TH forward: CCGTCATGCCTCCTCACCTATG and reverse: CCTGGGAGAACTGGGCAAATG.

Protein expression, purification, and fluorescence polarization assay

Escherichia coli transformed with a PICK1 encoding plasmid (pET41; Madsen et al., 2005) were inoculated overnight in 50 ml of lysogeny broth media (+kanamycin), diluted into 1-l lysogeny broth media (+kanamycin) and grown at 37°C to OD 0.6. Protein expression was induced with 0.5 mM IPTG and grown overnight at 20°C. Cells were harvested and resuspended in lysis buffer containing 50 mM Tris, 125 mM NaCl, 2 mM DTT (Sigma), 1% Triton X-100 (Sigma), 20-µg/ml DNase 1, and cOmplete protease inhibitor cocktail (Roche). Lysate was frozen at -80°C to induce cell lysis. The bacterial suspension was thawed and cleared by centrifugation (F20 rotor, 36,000 × g for 30 min at 4°C). Supernatant was incubated with glutathione-sepharose 4B beads (GE Healthcare) for 2 h at 4°C under gentle rotation. The beads were pelleted at 4000 × g for 5 min and washed twice in 50 mM Tris, 125 mM NaCl, 2 mM DTT, and 0.01% Triton X-100. Beads were transferred to a PD10 gravity column and were washed three times. Protein was separated from GST by thrombin (Millipore) incubation overnight at 4°C with gentle rotation. PICK1 was eluted on ice and absorption at 280 nm was measured on a TECAN plate reader, followed by protein concentration calculations using lambert beers law (A = εcl), εA280PICK1 = 32320(cm*mol/l)-1. A peptide of the 11 most C-terminal residues of mouse TH (HTLTQALSAIS) was ordered from TAGcopenhagen A/S with >95% purity. The peptide was dissolved in 10% DMSO and wash buffer to a concentration of 2 mM, and a final assay max concentration of 1 mM was used. The fluorescence polarization assay was performed as previously described (Madsen et al., 2005; Erlendsson et al., 2014) with a fixed concentration of PICK1 (1 µM, nonsaturated) and fluorescent tracer (Oregon-Green DATC13, 20 nM), preincubated for 15 min after which increasing concentrations of unlabeled TH-C11 peptide were added and incubated for 20 min on ice in a black 190-µl nonbinding surface 96-well plate (Corning). Fluorescence polarization was measured on an Omega POLARstar plate reader, 488-nm excitation and 535-nm emission.

Confocal microscopy

Confocal microscopy was performed using a Zeiss LSM 510 confocal laser-scanning microscope with an oil immersion 63 × 1.4 numerical aperture objective (Carl Zeiss). Alexa Fluor 488 dye was excited with a 488-nm laserline from an argon-krypton laser and emitted light detected using a 505- to 530-nm bandpass filter. Alexa Fluor 568 dye was excited with a 543-nm helium-neon laser, and fluorescence was recorded using a 560-nm long-pass filter. Images were analyzed with ImageJ (FIJI) software.

Immunohistochemistry of perfused brain sections for confocal microscopy

Adult mice were anaesthetized and transcardially perfused with 4% paraformaldehyde in 0.1 M PBS. Coronal midbrain sections (40 μm) were used for fluorescence immunohistochemistry. Initially, antigen retrieval was performed by treatment with 10 mM sodium citrate buffer (pH 6.0) for 30 min at 80°C. Brain sections were then rinsed in PBS and preincubated in PBS containing 5% goat serum, 1% bovine serum albumin and 0.3% Triton X-100 for 1 h. Sections were subsequently incubated with a custom generated mouse monoclonal PICK1 antibody (1:1000, 2G10; described in Jansen et al., 2009) and rabbit polyclonal TH (1:1000, OPA-04050, Affinity Bioreagents) at 4°C overnight. Sections were rinsed in washing buffer (0.25% BSA, 0.1% Triton X-100 in PBS) and then incubated with biotinylated goat anti-mouse (1:400, E0433, DAKO Cytomation A/S) or Alexa Fluor 568 goat anti-rabbit IgG (1:1000, A11036, Invitrogen). Following rinsing, slices were incubated with avidin-biotin-peroxidase complex (Vector Laboratories), rinsed, and incubated with biotinyl tyramide amplification reagent (PerkinElmer) and incubated with streptavidin-conjugated Alexa Fluor 488 (1:400, S11223, Thermo Fisher Scientific) to detect PICK1. Additional rinsing was followed by mounting on SuperFrost slides (Menzel-Gläser, Braunschweig, Germany) and cover-slipping using Prolong Gold antifade reagent (Invitrogen).

Culturing, transduction, and immunocytochemistry of dopaminergic neurons for confocal microscopy

Dopaminergic neurons were isolated from ventral midbrain tissue dissected from 1- to 3-d-old rat pups and plated on a monolayer of glia cells on coverslips using a protocol modified from (Rayport et al., 1992) as described in (Eriksen et al., 2009). For lentiviral transduction of the neurons, vectors were driven by the dual promoter FUGW with the H1 promoter driving the expression of the small hairpin (ShPICK1) targeting the PICK1 sequence (CTATGAGTACCGCCTTATCCT) and the ubiquitin promoter driving the expression of GFP (PICK1 KD; Citri et al., 2010). In the control vector (GFP), the sequence of the ShPICK1 was removed before the PCR product of the deleted ShPICK1 fragment and the PICK1 KD vector was digested and ligated together using AfeI and BamHI. Removal of ShPICK1 was achieved by synthesis of a 500 bp PCR fragment using the primers AGTAACGGATCCTTTTTCTAGCCCCAAGGGCG and TCGCCGAGAAGGGACTACTTTTCCTCGCCTG and the original PICK1 KD construct as template. Consequently, the control GFP vector only drives the expression of GFP under the ubiquitin promoter. Verification of both constructs was performed by dideoxynucleotide sequencing (Eurofins Genomics, Ebersberg, Germany). Transduction of dopaminergic neurons was initiated the first day after plating dopaminergic neurons on the monolayer of glia cells. Before transduction, half the medium was removed from each well and kept in incubator. Equal amounts of virus inducing expression of either PICK1 KD or GFP were added below the medium surface in two to three spots. After 6–8 h, the media was transferred back to the dopaminergic neurons and 5-fluorodeoxyuridine was added to the medium to inhibit cell growth. For immunocytochemistry, dopaminergic neurons were washed followed by 15-min fixation in 4% paraformaldehyde. Cells were washed followed by 20 min in permeabilization + blocking buffer (0.2% saponin + 5% goat serum in PBS). Neurons were stained with a rabbit anti-TH antibody (1:1000, OPA1-04050, Thermo Fischer Scientific) and a mouse anti-PICK1 antibody (2G10; described in (Jansen et al., 2009), 1:1000) for 1 h at room temperature. Cells were washed in blocking buffer and incubated for 45 min with Alexa Fluor 568 goat anti-rabbit and Alexa Fluor 647 goat anti-mouse (both 1:500, Life Technologies).

Statistical analysis

The dataset was examined for normality (Shapiro–Wilk and Kolmogorov–Smirnov normality test), outliers were removed by Grubbs outlier analysis, and all data are presented as mean ± SEM. Significance level was set to p < 0.05. GraphPad Prism was used for data analyses except for three-way ANOVAs, which were analyzed in SPSS. All statistical analysis run are reported in detail in Table 1.

Data were compared between groups using unpaired t tests when a Gaussian distribution was observed. Otherwise, the unparametric Mann–Whitney test was used. When comparing two normalized groups, with wild type set to 1 (Western blotting), one-sample t test was used. For cocaine administration without habituation of animals, as well as the self-administration paradigm, we used a two-way ANOVA with genotype and dose as factors. F values are reported as F (degrees of freedom between groups, degrees of freedom within groups). Pairwise multiple comparison procedures were made using the Holm–Sidak method. For drug-induced locomotion with habituation of animals as well as the sensitization paradigm, we instead used a three-way ANOVA with genotype, injection (before vs after drug) and dose as factors.