Article Figures & Data
Figures
- Figure 1.
Developmental expression pattern of Neto1 and Neto2 in the hippocampus. A, RT-qPCR analysis of Neto1 and Neto2 mRNA expression in the hippocampus. Data from three independent samples/group is represented as a percentage of the level at P4. B, Example images showing staining with sense and antisense RNA probes against Neto1 and Neto2 in hippocampal sections. For analysis, the intensity of the ISH stain (red) is normalized to the number of cells within the analyzed region, identified with the DAPI stain (blue; upper row). The lower panels show the ISH stain as grayscale image. Dashed lines delineate the principal cell body layer. Scale bar, 100 µm. C, Example images illustrating the ISH with antisense Neto1 and Neto2 probes at P4 and P14 hippocampal sections. Dashed lines show the principal cell layer. Scale bar, 100 µm. D, Quantified data on the mean intensity of the ISH stain for Neto1 and Neto2 in areas CA1, CA3, and DG at P4 and P14 (n = 3–4 samples/group).
- Figure 2.
Subcellular localization of recombinant NETO proteins in hippocampal neurons. A, Example images of hippocampal neurons expressing recombinant NETO1-HA and NETO2-HA (blue). MAP2 (purple) negative axons are marked with arrowheads. Cell morphology is visualized with GFP (green) expression. Scale bar, 10 µm. B, Quantified data demonstrating delivery of lentivirally expressed NETO1-HA and NETO2-HA (blue) to MAP2-positive (purple) dendritic (NETO1-HA n = 31, NETO2-HA n = 39) and MAP2-negative axonal (NETO1-HA n = 27, NETO2-HA n = 26) processes in cultured hippocampal neurons. For quantification, the signal intensity in the neurites is normalized to the soma intensity. Scale bar, 10 µm. C, Example images and quantified data demonstrating colocalization of lentivirally expressed NETO1-HA (n = 27) and NETO2-HA (n = 26; blue) with presynaptic marker synaptophysin (Syn) (red). Scale bar, 10 µm.
- Figure 3.
Loss of NETO1 leads to impaired GluK1c delivery to distal axons. A, RT-PCR data depicting Neto1, Neto2, and housekeeping gene Gapdh expression in WT dispersed hippocampal neuron culture throughout the culture period (DIV4, DIV6, DIV11, and DIV14). B, Quantified data on the delivery of recombinant KAR subunits to distal axons in WT hippocampal neurons. K1b: flag-GluK1b (n = 45), K1c: flag-GluK1c (n = 24), K2: myc-GluK2 (n = 39), K4: myc-GluK4 (n = 30), and K5: myc-GluK5 (n = 41). Signal intensity in distal axons is normalized to intensity in cell soma. C, Example images of WT neurons expressing recombinant flag-GluK1b, flag-GluK1c, myc-GluK2, myc-GluK4, or myc-GluK5 (blue). MAP2 (purple) negative axons are marked with arrowheads. Cell morphology is visualized with GFP (green) expression. Scale bar, 10 µm. D, Example images illustrating delivery of various recombinant KAR subunits (blue) to distal (>150 µm from soma) MAP2 negative axons in WT, Neto1 −/−, and Neto2 −/− neurons. Scale bar, 10 µm. E, Averaged data comparing KAR subunit delivery to WT versus Neto1 −/− or Neto2 −/− axons. K1b n = 47 and n = 24, K1c n = 13 and n = 29, K2 n = 41 and n = 34, K4 n = 18 and n = 22, K5 n = 34 and n = 48 for Neto1 −/− and Neto2 −/−, respectively. Data are presented as % of corresponding values in the WT axons.
- Figure 4.
NETO1 is required for tonic activity of KARs at CA3-CA1 synapse in the neonatal hippocampus. A, Example traces illustrating recording of mEPSCs from CA1 pyramidal neurons in WT, Neto1 −/−, and Neto2 −/− slices (P5), under control conditions and in the presence of ACET (200 nM). B, time-course plots and averaged data demonstrating the effect of ACET (200 nM) on mEPSC frequency in WT (n = 7) and Neto2 −/− (n = 5), and Neto1 −/− (n = 7) slices (P4-P6). C, Example traces and pooled data demonstrating short-term facilitation of EPSCs in response to five-pulse 50-Hz stimulation in WT (n = 7) and Neto2 −/− (n = 8), but not in Neto1 −/− (n = 14) slices (P4-P6).
- Figure 5.
NETO1 deficiency leads to loss of functional presynaptic KARs at immature CA3-CA1 synapses that is rescued with GluK1c overexpression in the area CA3. A, Example traces and pooled data showing that ATPA (1 µM) decreases synaptic transmission at CA3-CA1 synapse in WT (n = 6) and Neto2 −/− (n = 7), but not in Neto1 −/− (n = 9) acute slices (P4-P6). B, Example traces and pooled data showing the effect of ATPA (1 µM) on EPSCs in two week old (P14-P16) WT (n = 7) and Neto1 −/− (n = 8) acute slices. C, Example traces of mEPSCs recorded from CA1 pyramidal neurons in WT and Neto1 −/− organotypic cultures expressing GFP or GluK1c in CA3 pyramidal layer, under control conditions (trace 1), in the presence of ACET (200 nM; trace 2), and during washout (trace 3). Images show the GFP or GluK1c/GFP expression in the CA3 pyramidal layer in the corresponding cultures (scale bar, 20 µm). D, Time-course plot demonstrating the effect of ACET (200 nM) on mEPSC frequency in WT organotypic cultures expressing GFP (WT n = 7) in area CA3. E, Time-course plot demonstrating the effect of ACET (200 nM) on mEPSC frequency in Neto1 −/− organotypic cultures expressing GFP (n = 5) or GluK1c (n = 4) in area CA3. F, Pooled data for the experiments depicted in D, E.
- Figure 6.
Loss of axonal GluK1c in Neto1 −/− neurons results in reduced density of synaptophysin immunopositive (Syn) puncta. A, Example images of Syn puncta (red) in MAP2 negative WT, Neto1 −/−, and Neto2 −/− axons with lentiviral expression of GFP, GFP + flag-GluK1b, GFP + flag-GluK1c, or GFP + myc-GluK2. For clarity, the blue channel with flag/myc staining is not shown. Scale bar, 10 µm. B, Quantification of the Syn puncta (red) density in the three genotypes with lentiviral expression of GFP (WT n = 31; Neto1 −/− n = 36; Neto2 −/− n = 28), GFP + flag-GluK1b (WT n = 28; Neto1 −/− n = 29; Neto2 −/− n = 24), GFP + flag-GluK1c (WT n = 28; Neto1 −/− n = 19; Neto2 −/− n = 31), or GFP + myc-GluK2 (WT n = 40; Neto1 −/− n = 30; Neto2 −/− n = 27).
- Figure 7.
Neto1-dependent axonal targeting of GluK1c is required for developmental synchronization of the CA3-CA1 circuit. A, Example traces illustrating spontaneous activity in CA3 and CA1 regions of WT and Neto1 −/− hippocampal slices cultured on MEA probes at DIV2 and DIV6. B, Quantification of spike frequency and burst frequency in WT (DIV2 n = 12, DIV6 n = 11) and Neto1 −/− (DIV2 n = 12, DIV6 n = 13) slices. Data are averaged from at least two channels located in CA3 and in CA1 pyramidal regions/slice. C, Averaged data for STTCCA3,CA1 measuring temporal correlation of spiking activity between CA3 and CA1 subregions in Neto1 −/− (n = 12) and WT (n = 11) slices. D, Images showing GFP and GluK1c/GFP expression in CA3 principal cells in Neto1 −/− slices. Example traces demonstrate the activity in the virally transduced region of the corresponding slice cultures at DIV6. Scale bar, 150 µm. E, Quantification of spike frequency and burst frequency for nonmanipulated (ctrl, n = 7), GFP (n = 7)-, or GluK1c/GFP (n = 8)-expressing CA3 cell populations in Neto1 −/− slices at DIV6. F, Analysis of the STTCCA3,CA1 in Neto1−/− (DIV6) slices were the CA3 cell populations have been virally transduced to express GFP (n = 7) or GluK1c/GFP (n = 8).
Tables
Target Forward Reverse Neto1 TCATAGAAGCTGCCCCAAGG AAGCCAAAGGGTCCATCTCG Neto2 TTTGGAAGCTGCTCCTCGTC TCCAAGTGATCAAACCGGCA Gapdh CAGTGCCAGCCTCGTCTCATA TGGTAACCAGGCGTCCGATA Target Forward Reverse Neto1 TGAGTTTGAGATGGGCGGCC ACTGGTGTTGGTCAGCTGAT Neto2 CTGATGGAATAGTGCGGTCT GATCGTCCCATGAGTCTTCG Gapdh CAACGACCCCTTCATTGACC AGTGATGGCATGGACTGTGG Protein Promoter Tag Tag location GFP CMV — — GluK1b(Q) CMV Flag N terminus, after signal sequence GluK1c(Q) CMV Flag N terminus, after signal sequence GluK2(Q) CMV myc N terminus, after signal sequence GluK4 CMV myc N terminus, after signal sequence GluK5 CMV myc N terminus, after signal sequence NETO1 CMV HA C terminus NETO2 CMV HA C terminus
In this issue
