Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT

User menu

Search

  • Advanced search
eNeuro
eNeuro

Advanced Search

 

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT
PreviousNext
Research ArticleNew Research, Neuronal Excitability

NETO1 Guides Development of Glutamatergic Connectivity in the Hippocampus by Regulating Axonal Kainate Receptors

Ester Orav, Tsvetomira Atanasova, Alexandra Shintyapina, Sebnem Kesaf, Michela Kokko, Juha Partanen, Tomi Taira and Sari E. Lauri
eNeuro 22 June 2017, 4 (3) ENEURO.0048-17.2017; https://doi.org/10.1523/ENEURO.0048-17.2017
Ester Orav
1Neuroscience Center, University of Helsinki, Helsinki FI-00014, Finland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tsvetomira Atanasova
1Neuroscience Center, University of Helsinki, Helsinki FI-00014, Finland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Tsvetomira Atanasova
Alexandra Shintyapina
1Neuroscience Center, University of Helsinki, Helsinki FI-00014, Finland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Alexandra Shintyapina
Sebnem Kesaf
1Neuroscience Center, University of Helsinki, Helsinki FI-00014, Finland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Sebnem Kesaf
Michela Kokko
1Neuroscience Center, University of Helsinki, Helsinki FI-00014, Finland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Juha Partanen
2Department of Biosciences, University of Helsinki, Helsinki FI-00014, Finland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tomi Taira
1Neuroscience Center, University of Helsinki, Helsinki FI-00014, Finland
3Department of Veterinary Biosciences, University of Helsinki, Helsinki FI-00014, Finland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sari E. Lauri
1Neuroscience Center, University of Helsinki, Helsinki FI-00014, Finland
2Department of Biosciences, University of Helsinki, Helsinki FI-00014, Finland
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Sari E. Lauri
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Figure 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1.

    Developmental expression pattern of Neto1 and Neto2 in the hippocampus. A, RT-qPCR analysis of Neto1 and Neto2 mRNA expression in the hippocampus. Data from three independent samples/group is represented as a percentage of the level at P4. B, Example images showing staining with sense and antisense RNA probes against Neto1 and Neto2 in hippocampal sections. For analysis, the intensity of the ISH stain (red) is normalized to the number of cells within the analyzed region, identified with the DAPI stain (blue; upper row). The lower panels show the ISH stain as grayscale image. Dashed lines delineate the principal cell body layer. Scale bar, 100 µm. C, Example images illustrating the ISH with antisense Neto1 and Neto2 probes at P4 and P14 hippocampal sections. Dashed lines show the principal cell layer. Scale bar, 100 µm. D, Quantified data on the mean intensity of the ISH stain for Neto1 and Neto2 in areas CA1, CA3, and DG at P4 and P14 (n = 3–4 samples/group).

  • Figure 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2.

    Subcellular localization of recombinant NETO proteins in hippocampal neurons. A, Example images of hippocampal neurons expressing recombinant NETO1-HA and NETO2-HA (blue). MAP2 (purple) negative axons are marked with arrowheads. Cell morphology is visualized with GFP (green) expression. Scale bar, 10 µm. B, Quantified data demonstrating delivery of lentivirally expressed NETO1-HA and NETO2-HA (blue) to MAP2-positive (purple) dendritic (NETO1-HA n = 31, NETO2-HA n = 39) and MAP2-negative axonal (NETO1-HA n = 27, NETO2-HA n = 26) processes in cultured hippocampal neurons. For quantification, the signal intensity in the neurites is normalized to the soma intensity. Scale bar, 10 µm. C, Example images and quantified data demonstrating colocalization of lentivirally expressed NETO1-HA (n = 27) and NETO2-HA (n = 26; blue) with presynaptic marker synaptophysin (Syn) (red). Scale bar, 10 µm.

  • Figure 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3.

    Loss of NETO1 leads to impaired GluK1c delivery to distal axons. A, RT-PCR data depicting Neto1, Neto2, and housekeeping gene Gapdh expression in WT dispersed hippocampal neuron culture throughout the culture period (DIV4, DIV6, DIV11, and DIV14). B, Quantified data on the delivery of recombinant KAR subunits to distal axons in WT hippocampal neurons. K1b: flag-GluK1b (n = 45), K1c: flag-GluK1c (n = 24), K2: myc-GluK2 (n = 39), K4: myc-GluK4 (n = 30), and K5: myc-GluK5 (n = 41). Signal intensity in distal axons is normalized to intensity in cell soma. C, Example images of WT neurons expressing recombinant flag-GluK1b, flag-GluK1c, myc-GluK2, myc-GluK4, or myc-GluK5 (blue). MAP2 (purple) negative axons are marked with arrowheads. Cell morphology is visualized with GFP (green) expression. Scale bar, 10 µm. D, Example images illustrating delivery of various recombinant KAR subunits (blue) to distal (>150 µm from soma) MAP2 negative axons in WT, Neto1 −/−, and Neto2 −/− neurons. Scale bar, 10 µm. E, Averaged data comparing KAR subunit delivery to WT versus Neto1 −/− or Neto2 −/− axons. K1b n = 47 and n = 24, K1c n = 13 and n = 29, K2 n = 41 and n = 34, K4 n = 18 and n = 22, K5 n = 34 and n = 48 for Neto1 −/− and Neto2 −/−, respectively. Data are presented as % of corresponding values in the WT axons.

  • Figure 4.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 4.

    NETO1 is required for tonic activity of KARs at CA3-CA1 synapse in the neonatal hippocampus. A, Example traces illustrating recording of mEPSCs from CA1 pyramidal neurons in WT, Neto1 −/−, and Neto2 −/− slices (P5), under control conditions and in the presence of ACET (200 nM). B, time-course plots and averaged data demonstrating the effect of ACET (200 nM) on mEPSC frequency in WT (n = 7) and Neto2 −/− (n = 5), and Neto1 −/− (n = 7) slices (P4-P6). C, Example traces and pooled data demonstrating short-term facilitation of EPSCs in response to five-pulse 50-Hz stimulation in WT (n = 7) and Neto2 −/− (n = 8), but not in Neto1 −/− (n = 14) slices (P4-P6).

  • Figure 5.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 5.

    NETO1 deficiency leads to loss of functional presynaptic KARs at immature CA3-CA1 synapses that is rescued with GluK1c overexpression in the area CA3. A, Example traces and pooled data showing that ATPA (1 µM) decreases synaptic transmission at CA3-CA1 synapse in WT (n = 6) and Neto2 −/− (n = 7), but not in Neto1 −/− (n = 9) acute slices (P4-P6). B, Example traces and pooled data showing the effect of ATPA (1 µM) on EPSCs in two week old (P14-P16) WT (n = 7) and Neto1 −/− (n = 8) acute slices. C, Example traces of mEPSCs recorded from CA1 pyramidal neurons in WT and Neto1 −/− organotypic cultures expressing GFP or GluK1c in CA3 pyramidal layer, under control conditions (trace 1), in the presence of ACET (200 nM; trace 2), and during washout (trace 3). Images show the GFP or GluK1c/GFP expression in the CA3 pyramidal layer in the corresponding cultures (scale bar, 20 µm). D, Time-course plot demonstrating the effect of ACET (200 nM) on mEPSC frequency in WT organotypic cultures expressing GFP (WT n = 7) in area CA3. E, Time-course plot demonstrating the effect of ACET (200 nM) on mEPSC frequency in Neto1 −/− organotypic cultures expressing GFP (n = 5) or GluK1c (n = 4) in area CA3. F, Pooled data for the experiments depicted in D, E.

  • Figure 6.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 6.

    Loss of axonal GluK1c in Neto1 −/− neurons results in reduced density of synaptophysin immunopositive (Syn) puncta. A, Example images of Syn puncta (red) in MAP2 negative WT, Neto1 −/−, and Neto2 −/− axons with lentiviral expression of GFP, GFP + flag-GluK1b, GFP + flag-GluK1c, or GFP + myc-GluK2. For clarity, the blue channel with flag/myc staining is not shown. Scale bar, 10 µm. B, Quantification of the Syn puncta (red) density in the three genotypes with lentiviral expression of GFP (WT n = 31; Neto1 −/− n = 36; Neto2 −/− n = 28), GFP + flag-GluK1b (WT n = 28; Neto1 −/− n = 29; Neto2 −/− n = 24), GFP + flag-GluK1c (WT n = 28; Neto1 −/− n = 19; Neto2 −/− n = 31), or GFP + myc-GluK2 (WT n = 40; Neto1 −/− n = 30; Neto2 −/− n = 27).

  • Figure 7.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 7.

    Neto1-dependent axonal targeting of GluK1c is required for developmental synchronization of the CA3-CA1 circuit. A, Example traces illustrating spontaneous activity in CA3 and CA1 regions of WT and Neto1 −/− hippocampal slices cultured on MEA probes at DIV2 and DIV6. B, Quantification of spike frequency and burst frequency in WT (DIV2 n = 12, DIV6 n = 11) and Neto1 −/− (DIV2 n = 12, DIV6 n = 13) slices. Data are averaged from at least two channels located in CA3 and in CA1 pyramidal regions/slice. C, Averaged data for STTCCA3,CA1 measuring temporal correlation of spiking activity between CA3 and CA1 subregions in Neto1 −/− (n = 12) and WT (n = 11) slices. D, Images showing GFP and GluK1c/GFP expression in CA3 principal cells in Neto1 −/− slices. Example traces demonstrate the activity in the virally transduced region of the corresponding slice cultures at DIV6. Scale bar, 150 µm. E, Quantification of spike frequency and burst frequency for nonmanipulated (ctrl, n = 7), GFP (n = 7)-, or GluK1c/GFP (n = 8)-expressing CA3 cell populations in Neto1 −/− slices at DIV6. F, Analysis of the STTCCA3,CA1 in Neto1−/− (DIV6) slices were the CA3 cell populations have been virally transduced to express GFP (n = 7) or GluK1c/GFP (n = 8).

Tables

  • Figures
    • View popup
    Table 1.

    RT-qPCR primers

    TargetForwardReverse
    Neto1TCATAGAAGCTGCCCCAAGGAAGCCAAAGGGTCCATCTCG
    Neto2TTTGGAAGCTGCTCCTCGTCTCCAAGTGATCAAACCGGCA
    GapdhCAGTGCCAGCCTCGTCTCATATGGTAACCAGGCGTCCGATA
    • View popup
    Table 2.

    Primers used for RT-PCR and for synthesis of ISH probes against Neto1 and Neto2

    TargetForwardReverse
    Neto1TGAGTTTGAGATGGGCGGCCACTGGTGTTGGTCAGCTGAT
    Neto2CTGATGGAATAGTGCGGTCTGATCGTCCCATGAGTCTTCG
    GapdhCAACGACCCCTTCATTGACCAGTGATGGCATGGACTGTGG
    • View popup
    Table 3.

    Lentiviral constructs used in this study

    ProteinPromoterTagTag location
    GFPCMV——
    GluK1b(Q)CMVFlagN terminus, after signal sequence
    GluK1c(Q)CMVFlagN terminus, after signal sequence
    GluK2(Q)CMVmycN terminus, after signal sequence
    GluK4CMVmycN terminus, after signal sequence
    GluK5CMVmycN terminus, after signal sequence
    NETO1CMVHAC terminus
    NETO2CMVHAC terminus
Back to top

In this issue

eneuro: 4 (3)
eNeuro
Vol. 4, Issue 3
May/June 2017
  • Table of Contents
  • Index by author
Email

Thank you for sharing this eNeuro article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
NETO1 Guides Development of Glutamatergic Connectivity in the Hippocampus by Regulating Axonal Kainate Receptors
(Your Name) has forwarded a page to you from eNeuro
(Your Name) thought you would be interested in this article in eNeuro.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
NETO1 Guides Development of Glutamatergic Connectivity in the Hippocampus by Regulating Axonal Kainate Receptors
Ester Orav, Tsvetomira Atanasova, Alexandra Shintyapina, Sebnem Kesaf, Michela Kokko, Juha Partanen, Tomi Taira, Sari E. Lauri
eNeuro 22 June 2017, 4 (3) ENEURO.0048-17.2017; DOI: 10.1523/ENEURO.0048-17.2017

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Share
NETO1 Guides Development of Glutamatergic Connectivity in the Hippocampus by Regulating Axonal Kainate Receptors
Ester Orav, Tsvetomira Atanasova, Alexandra Shintyapina, Sebnem Kesaf, Michela Kokko, Juha Partanen, Tomi Taira, Sari E. Lauri
eNeuro 22 June 2017, 4 (3) ENEURO.0048-17.2017; DOI: 10.1523/ENEURO.0048-17.2017
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
    • Synthesis
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • Auxiliary Subunit
  • development
  • GluK1
  • hippocampus
  • Kainate Receptor
  • NETO

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

New Research

  • A Very Fast Time Scale of Human Motor Adaptation: Within Movement Adjustments of Internal Representations during Reaching
  • Optogenetic Activation of β-Endorphin Terminals in the Medial Preoptic Nucleus Regulates Female Sexual Receptivity
  • Hsc70 Ameliorates the Vesicle Recycling Defects Caused by Excess α-Synuclein at Synapses
Show more New Research

Neuronal Excitability

  • Assessment of cell-type-specific excitatory synaptic strength in the dorsolateral striatum of goal-directed and habitual cocaine-seeking behavior
  • Role of Concentration in Opposing Effects of Anandamide on Nociceptive Synapses versus Non-nociceptive Synapses
  • Motor Protein Disruption Critically Alters Organelle Trafficking and Excitation–Contraction Coupling
Show more Neuronal Excitability

Subjects

  • Neuronal Excitability
  • Home
  • Alerts
  • Follow SFN on BlueSky
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Latest Articles
  • Issue Archive
  • Blog
  • Browse by Topic

Information

  • For Authors
  • For the Media

About

  • About the Journal
  • Editorial Board
  • Privacy Notice
  • Contact
  • Feedback
(eNeuro logo)
(SfN logo)

Copyright © 2026 by the Society for Neuroscience.
eNeuro eISSN: 2373-2822

The ideas and opinions expressed in eNeuro do not necessarily reflect those of SfN or the eNeuro Editorial Board. Publication of an advertisement or other product mention in eNeuro should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in eNeuro.