Article Figures & Data
Figures
- Figure 1.
Experimental procedure. Seven days after birth (P7), male pups from two different transgenic strains: the GIN mice (Oliva et al. 2000), which express EGFP in interneurons, and the THY1 mice (Feng et al. 2000), which express the YFP in pyramidal neurons) were intraperitoneally injected with MK801 or NaCl (vehicle solution). After weaning (P21), mice were randomly selected and housed alone (isolation) or in groups of four mice (social rearing) for 10 weeks. At P90, all mice were tested in the hole-board apparatus. Brains from GIN molecular mice were destined to protein and gene expression studies, whereas brains from GIN structure mice were used for the structural and neurochemical analysis of interneurons. The THY structure set of mice was used to study structural alterations of pyramidal neurons. For further details, see Material and Methods.
- Figure 2.
Behavioral analysis of GAD-EGFP expressing mice. A, Representative track-plot reports recorded during the hole-board test session (ANY-maze). Observe the increased distance traveled (purple line) in the two groups subjected to post-weaning isolation, especially in the border of the apparatus. Social isolation rearing increased locomotor activity (B) and anxiety-related behavior (D) but did not change exploratory behavior (number of head dips into novel holes/total number of head dips; C). Gray lines in graphs (B–D) represent statistically significant effects of rearing in a two-way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001.
- Figure 3.
Behavioral analysis of Thy1-YFP expressing mice. A, Representative track-plot reports showing the increased distance traveled (purple line) of double-hit mice (MK801-Isolation group) in the hole-board test compared with the other groups. Double-hit mice showed increased locomotor activity (B) and anxiety-related behavior (D) but no changes in exploratory behavior (number of head dips into novel holes/total number of head dips; C). B–D, Horizontal lines in graphs represent statistically significant effects of MK801 treatment (black), rearing (gray), or interaction (gray, dashed) in a two-way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001. Colored symbols in bars represent trends and statistically significant differences among groups after post hoc analysis: # 0.1 > p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.
- Figure 4.
Volumetric analysis. Treatment, rearing, and the interaction of both treatments influenced the volume of the amygdala and the PFC. Although the total volume of both regions was not significantly affected (A), the volume of some nuclei of the amygdala (B, C) and some regions of the PFC (D, E) was affected by treatment (BMA, Cg1), rearing (BLA, IL), or their interaction (Ce, Cg1). Horizontal lines in graphs represent trends and statistically significant effects of MK801 treatment (black), rearing (gray), or interaction (gray, dashed) in a two-way ANOVA. # 0.1 > p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001. Colored symbols in bars represent trends and statistically significant differences among groups after post hoc analysis: # 0.1 > p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001. B, D, Schematic representations of the regions that were measured in our volumetric study (amygdala: all brain slices from bregma −0.58 to −2.30 mm; PFC: all brain slices from bregma +2.96 to −0.22 mm).
- Figure 5.
Structural analysis of pyramidal neurons. A, Panoramic view of the PFC of THY1-YFP expressing mice. Arrowheads point to fluorescent pyramidal neurons. B, Representative confocal image of a pyramidal neuron from these animals. C1 (NaCl-Group) and C2 (MK801-Isolation) represent sections of the spiny apical dendrites of these pyramidal neurons. D, E, Graphs showing the results of the analysis of dendritic spine density. D, The segmented analysis of the spine densities only showed a significant interaction effect in the first segment (0–50 µm of distance from the soma; Table 3) but no statistically significant differences among groups where observed after post hoc comparison. Despite the significant effects of treatment or rearing in some of the other segments (Table 3), the interaction (two-way ANOVA) was not significant in any of them and, therefore, post hoc comparisons were not applicable (n/a). E, No statistical significant effects of treatment, rearing, or their interaction (two-way ANOVA) were observed when analyzing the spines density of the total length of the dendrite (200 µm). Scale bars: A, 100 µm; B, 20 µm; C1, C2, 2.5 µm.
- Figure 6.
Structural analysis of interneurons. Panoramic view of the amygdala (A) and PFC (H) of GIN mice. B1, B2, I1, I2, Representative 3D reconstructions of the dendritic arbor of GAD-EGFP expressing interneurons. Double-hit mice showed increased dendritic arborization (number of intersections in the Sholl analysis) in interneurons form the amygdala (D, E) but not from the PFC (K, L). C1, C2, J1, J2, Representative images of spiny dendrites from GAD-EGFP expressing interneurons. Insets are magnified views of the squared sections of their respective images. Arrowheads point to dendritic spines. Analysis of the dendritic spines showed increased density in the PFC (M, N) but not in the amygdala (F, G) of double-hit mice. Horizontal lines in graphs (E, N) represent statistically significant effects of MK801 treatment (black), rearing (gray), or interaction (gray, dashed) in a two-way ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001. Colored symbols (D, E, M, N) represent statistically significant differences among groups after post hoc analysis: *p < 0.05, **p < 0.01, ***p < 0.001. If the interaction (two-way ANOVA) was not significant, post hoc comparisons were not applicable (n/a). Scale bars: A, H, 800 µm; B, I, 40 µm; C, J, 14 µm; C, J (insets), 2 µm.
- Figure 7.
Excitatory and inhibitory neurotransmission. Schematic view of all the analyzed regions (A1, amygdala; B1, PFC). Right, Representative confocal images of excitatory (blue, VGLUT1) and inhibitory (red, VGAT) puncta in the neuropil of NaCl-Social and MK801-Isolated animals. Scale bars: images, 16 µm; insets, 6 µm. Significant differences in VGLUT1 puncta density (A2, B2), VGAT puncta density (A3, B3), and E/I ratio (A4, B4) among groups were observed. Horizontal lines in graphs represent trends and statistically significant effects of MK801 treatment (black), rearing (gray), or interaction (gray, dashed) in a two-way ANOVA. # 0.1 > p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001. Colored symbols in bars represent trends and statistically significant differences among groups after post hoc analysis: # 0.1 > p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.
- Figure 8.
Protein and gene expression studies. Bar graphs showing the presence or lack of effect of the treatment, rearing, or their interaction in GAD67, SYN, and PSA-NCAM protein expression (A–C) and in GAD67, BDNF, ErbB4, CB1-R, ST8SiaII, and ST8SiaIV mRNA levels (D–I). Horizontal lines in graphs represent trends and statistically significant effects of MK801 treatment (black), rearing (gray) or interaction (gray, dashed) in a two-way ANOVA. # 0.1 > p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001. J & K: Representative bands from immunoblots for GAD67 (J) and SYN (K) in the amygdala and the PFC.
- Figure 9.
Expression of PNNs in PV-immunoreactive neurons. A, Representative confocal images showing the distribution of PV (red) and PNNs (blue) in the different nuclei of the amygdala (left) and regions of the PFC (right) of GIN mice (GAD-GFP, green). The squared section in the panoramic images was 2× magnified to show the different nuclei and areas that were analyzed. In a detailed view (below), two PV-immunoreactive neurons expressing PNN can be observed. GAD-GFP expressing interneurons do not express PNN. Scale bars: panoramic views, 875 µm; detailed view, 25 µm. B, C, Treatment, rearing, or their interaction affected the total number of PV neurons (B1, C1), PNNs (B2, C2), or their colocalization (B3, C3) in some nuclei of the amygdala and regions of the PFC. Horizontal lines in graphs represent trends and statistically significant effects of MK801 treatment (black), rearing (gray), or interaction (gray, dashed) in a two-way ANOVA. # 0.1 > p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001. Colored symbols in bars represent trends and statistically significant differences among groups after post hoc analysis: # 0.1 > p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.
Tables
Target gene Primers Sequence (5′ → 3′) Amplicon size* GAD67 Forward
ReverseCTGGAGCTGGCTGAATACCT
TCGGAGGCTTTGTGGTATGT120 BDNF Forward
ReverseGGTTCGAGAGGTCTGACGAC
CAAAGGCACTTGACTGCTGA159 ErbB4 Forward
ReverseCAGTCGCCCAGGGTGCAACG
GCGAACACTGTGGGGTCGGC133 CB1-R Forward
ReverseTGTCCCTCACCCTGGGCACC
TCCCAGGAGATCGGCCACCG134 ST8SiaII Forward
ReverseGGCAACTCAGGAGTCTTGCT
GTCAGTCTTGAGGCCCACAT123 ST8SiaIV Forward
ReverseCCTTCATGGTCAAAGGAGGA
CCTTCATGGTCAAAGGAGGA125 Ywhaz Forward
ReverseTTGAGCAGAAGACGGAAGGT
GAAGCATTGGGGATCAAGAA136 ↵* Amplicon length in base pairs.
Parameter Main effects (two-way ANOVA) Group differences (from NaCl-Social) Treatment Rearing Interaction NaCl-Isolation MK801-Social MK801-Isolation Behavior (Figs. 2, 3) Locomotor activity Total distance travelled Gad-EGFP mice — ✓(1) — n/a n/a n/a Thy1-YFP mice ✓(2) ✓(3) ✓(4) — — ↑** Mean speed Gad-EGFP mice — ✓(5) — n/a n/a n/a Thy1-YFP mice ✓(6) ✓(7) ✓(8) — — ↑** Anxiety-related behavior Border distance Gad-EGFP mice — ✓(9) — n/a n/a n/a Thy1-YFP mice ✓(10) ✓(11) — n/a n/a n/a Border entries Gad-EGFP mice — ✓(12) — n/a n/a n/a Thy1-YFP mice ✓(13) ✓(14) ✓(15) — — ↑* Body rotations Gad-EGFP mice — ✓(16) — n/a n/a n/a Thy1-YFP mice ✓(17) ✓(18) ✓(19) ↑*** ↑* ↑*** Exploratory behavior Gad-EGFP mice — — — n/a n/a n/a Thy1-YFP mice — — — n/a n/a n/a Brain volume (Fig. 4) Amygdala Total volume — — #(20) n/a n/a n/a Central — — ✓(21) ↑* — — Lateral — — — n/a n/a n/a Basolateral — ✓(22) — n/a n/a n/a Basomedial ✓(23) — — n/a n/a n/a Medial — — — n/a n/a n/a PFC Total volume — #(24) — n/a n/a n/a IL — #(25) — n/a n/a n/a PrL — — — n/a n/a n/a Cg1 ✓(26) — ✓(27) — — ↓# Cg2 — — — n/a n/a n/a ↵Symbols: (✓) statistically significant effect (two-way ANOVA); (—) no statistically significant effect (two-way ANOVA) or difference from NaCl-Social group (post hoc); (↑) increase; (n/a) not applicable; (↓) decrease; *p < 0.05; **p < 0.01; ***p < 0.001; #0.10 ≥ p ≥ 0.05.
F and p values: (1) F(1,58) = 31.11, p < 10−6; (2) F(1,11) = 8.05, p = 0.016; (3) F(1,11) = 9.99, p = 0.009; (4) F(1,11) = 6.74, p = 0.025; (5) F(1,59) = 19.38, p = 4.6 × 10−5; (6) F(1,11) = 7.80, p = 0.018; (7) F(1,11) = 9.90, p = 0.009; (8) F(1,11) = 6.61, p = 0.026; (9) F(1,59) = 36.48, p < 10−7; (10) F(1,11) = 8.22, p = 0.015; (11) F(1,11) = 20.68, p = 0.001; (12) F(1,60) = 6.20, p = 0.016; (13) F(1,11) = 7.48, p = 0.019; (14) F(1,11) = 6.11, p = 0.031; (15) F(1,11) = 8.27, p = 0.015; (16) F(1,60) = 5.14, p = 0.027; (17) F(1,11) = 93.50, p = 10−5; (18) F(1,11) = 119.86, p < 10 − 6; (19) F(1,11) = 42.94, p = 4.1 × 10−5; (20) F(1,20) = 3.34, p = 0.082; (21) F(1,21) = 4.73, p = 0.041; (22) F(1,21) = 9.44, p = 0.0058; (23) F(1,21) = 5.82, p = 0.025; (24) F(1,23) = 3.39, p = 0.079; (25) F(1,23) = 3.61, p = 0.07; (26) F(1,22) = 5.062, p = 0.035; (27) F(1,22) = 6.62, p = 0.017.
Parameter Main effects (two-way ANOVA) Group differences (from NaCl-Social) Treatment Rearing Interaction NaCl-Isolation MK801-Social MK801-Isolation Structure of pyramidal neurons (Fig. 5) Dendritic spines PFC 50 — — ✓(28) — — — 100 — — — n/a n/a n/a 150 — ✓(29) — n/a n/a n/a 200 ✓(30) — — n/a n/a n/a Total — — — n/a n/a n/a Structure of interneurons (Fig. 6) Dendritic arborization Amygdala 20 — #(31) ✓(32) — — — 40 — ✓(33) ✓(34) — — ↑* 60 ✓(35) ✓(36) ✓(37) — — ↑*** 80 ✓(38) ✓(39) ✓(40) — — ↑* 100 ✓(41) ✓(42) #(43) n/a n/a n/a 120 ✓(44) ✓(45) ✓(46) — — ↑* 140 #(47) — — n/a n/a n/a 160 — — — n/a n/a n/a Total ✓(48) ✓(49) ✓(50) — — ↑*** PFC 20 — — — n/a n/a n/a 40 — — — n/a n/a n/a 60 — — — n/a n/a n/a 80 — — — n/a n/a n/a 100 — — — n/a n/a n/a 120 — — — n/a n/a n/a 140 — — — n/a n/a n/a 160 — — — n/a n/a n/a Total — — — n/a n/a n/a Dendritic spines Amygdala 50 — — — n/a n/a n/a 100 — — — n/a n/a n/a 150 — #(51) #(52) n/a n/a n/a Total — — — n/a n/a n/a PFC 50 #(53) ✓(54) #(55) n/a n/a n/a 100 ✓(56) ✓(57) ✓(58) ↑* ↑** ↑** 150 ✓(59) ✓(60) — n/a n/a n/a Total ✓(61) ✓(62) ✓(63) ↑** ↑*** ↑*** ↵Symbols: (✓) statistically significant effect (two-way ANOVA); (—) no statistically significant effect (two-way ANOVA) or difference from NaCl-Social group (post hoc); (↑) increase; (n/a) not applicable; (↓) decrease; *p < 0.05; **p < 0.01; ***p < 0.001; #0.10 ≥ p ≥ 0.05.
F and p values: (28) F(1,15) = 6.29, p = 0.024; (29) F(1,15) = 4.88, p = 0.043; (30) F(1,18) = 4.90, p = 0.043 (31) F(1,19) = 3.81, p = 0.066; (32) F(1,19) = 4.72, p = 0.043; (33) F(1,19) = 9.02, p = 0.007; (34) F(1,19) = 12.58, p = 0.002; (35) F(1,18) = 7.53, p = 0.013; (36) F(1,18) = 23.53, p = 12.8 × 10−5; (37) F(1,18) = 12.62, p = 0.002; (38) F(1,19) = 4.64, p = 0.044; (39) F(1,19) = 6.55, p = 0.019; (40) F(1,19) = 10.23, p = 0.005; (41) F(1,20) = 4.43, p = 0.048; (42) F(1,20) = 8.79, p = 0.008; (43) F(1,20) = 3.27, p = 0.086; (44) F(1,20) = 5.73, p = 0.027; (45) F(1,20) = 5.32, p = 0.032; (46) F(1,20) = 14.63, p = 0.0011; (47) F(1,20) = 4.34, p = 0.050; (48) F(1,20) = 8.31, p = 0.009; (49) F(1,20) = 14.29, p = 0.001; (50) F(1,20) = 18.23, p = 37.5 × 10−5; (51) F(1,22) = 3.79, p = 0.064; (52) F(1,22) = 3.34, p = 0.081; (53) F(1,22) = 3.74, p = 0.066; (54) F(1,22) = 4.53, p = 0.045; (55) F(1,22) = 3.31, p = 0.083; (56) F(1,22) = 11.72, p = 0.002; (57) F(1,22) = 5.50, p = 0.029; (58) F(1,22) = 5.18, p = 0.033; (59) F(1,22) = 5.50, p = 0.028; (60) F(1,22) = 7.43, p = 0.012; (61) F(1,22) = 21.08, p = 14.2 × 10−5; (62) F(1,22) = 6.27, p = 0.020; (63) F(1,22) = 10.18, p = 0.004.
Parameter Main effects (two-way ANOVA) Group differences (from NaCl-Social) Treatment Rearing Interaction NaCl-Isolation MK801-Social MK801-Isolation Density of neuropil puncta (Fig. 7) VGLUT1 (Amygdala) Central — — — n/a n/a n/a Lateral ✓(64) ✓(65) ✓(66) — — ↑* Basolateral — — — n/a n/a n/a Basomedial ✓(67) ✓(68) #(69) n/a n/a n/a Medial #(70) ✓(71) ✓(72) — — ↑* VGLUT1 (PFC) IL+PrL — — — n/a n/a n/a Cg1+Cg2 ✓(73) ✓(74) #(75) n/a n/a n/a VGAT (Amygdala) Central — #(76) — n/a n/a n/a Lateral — ✓(77) — n/a n/a n/a Basolateral #(78) #(79) #(80) n/a n/a n/a Basomedial #(81) ✓(82) — n/a n/a n/a Medial #(83) ✓(84) #(85) n/a n/a n/a VGAT (PFC) IL+PrL #(86) #(87) ✓(88) — ↑* — Cg1+Cg2 — ✓(89) — n/a n/a n/a E/I Balance (Fig. 7) Amygdala Central — — — n/a n/a n/a Lateral #(90) ✓(91) — n/a n/a n/a Basolateral — ✓(92) — n/a n/a n/a Basomedial — — — n/a n/a n/a Medial — — — n/a n/a n/a PFC IL+PrL #(93) ✓(94) ✓(95) — — ↑* Cg1+Cg2 ✓(96) ✓(97) — n/a n/a n/a ↵Symbols: (✓) statistically significant effect (two-way ANOVA); (-) no statistically significant effect (two-way ANOVA) or difference from NaCl-Social group (post hoc); (↑) increase; (n/a) not applicable; (↓) decrease; *p < 0.05; **p < 0.01; ***p < 0.001; #0.10 ≥ p ≥ 0.05.
F and p values: (64) F(1,29) = 4.58, p = 0.041; (65) F(1,29) = 7.12, p = 0.012; (66) F(1,29) = 4.20, p = 0.049; (67) F(1,28) = 4.89, p = 0.036; (68) F(1,28) = 6.08, p = 0.020; (69) F(1,28) = 3.17, p = 0.086; (70) F(1,29) = 3.74, p = 0.063; (71) F(1,29) = 4.32, p = 0.047; (72) F(1,29) = 5.01, p = 0.033; (73) F(1,19) = 6.31, p = 0.021; (74) F(1,19) = 8.44, p = 0.009; (75) F(1,19) = 3.54, p = 0.075; (76) F(1,29) = 3.45, p = 0.074; (77) F(1,28) = 5.28, p = 0.029; (78) F(1,29) = 3.09, p = 0.089; (79) F(1,29) = 3.88, p = 0.058; (80) F(1,29) = 2.91, p = 0.097; (81) F(1,29) = 3.16, p = 0.086; (82) F(1,29) = 4.29, p = 0.047; (83) F(1,29) = 3.47, p = 0.073; (84) F(1,29) = 5.88, p = 0.022; (85) F(1,29) = 3.05, p = 0.091; (86) F(1,18) = 3.75, p = 0.069; (87) F(1,18) = 3.88, p = 0.065; (88) F(1,18) = 6.53, p = 0.020; (89) F(1,19) = 21.12, p = 2 × 10−4; (90) F(1,29) = 3.55, p = 0.070; (91) F(1,29) = 9.01, p = 0.005; (92) F(1,28) = 6.75, p = 0.015; (93) F(1,18) = 3.93, p = 0.063; (94) F(1,18) = 6.18, p = 0.023; (95) F(1,18) = 6.39, p = 0.021; (96) F(1,18) = 10.72, p = 0.004; (97) F(1,18) = 8.33, p = 0.0098.
Parameter Main effects (two-way ANOVA) Group differences (from NaCl-Social) Treatment Rearing Interaction NaCl-Isolation MK801-Social MK801-Isolation Protein expression (Fig.7) GAD67 Amygdala — ✓(98) — n/a n/a n/a PFC — — — n/a n/a n/a SYN Amygdala — — — n/a n/a n/a PFC — — — n/a n/a n/a PSA-NCAM Amygdala ✓(99) ✓(100) #(101) n/a n/a n/a PFC ✓(102) — — n/a n/a n/a Gene expression (Fig.7) GAD67 Amygdala — — — n/a n/a n/a PFC #(103) — — n/a n/a n/a BDNF Amygdala — — — n/a n/a n/a PFC — ✓(104) — n/a n/a n/a ErbB4 Amygdala — — #(105) n/a n/a n/a PFC — — — n/a n/a n/a CB1-R Amygdala — ✓(106) — n/a n/a n/a PFC — — — n/a n/a n/a ST8SiaII Amygdala #(107) — — n/a n/a n/a PFC — — — n/a n/a n/a ST8SiaIV Amygdala — — — n/a n/a n/a PFC #(108) ✓(109) — n/a n/a n/a ↵Symbols: (✓) statistically significant effect (two-way ANOVA); (—) no statistically significant effect (two-way ANOVA) or difference from NaCl-Social group (post hoc); (↑) increase; (n/a) not applicable; (↓) decrease; (*) p < 0.05; (**) p < 0.01; (***) p < 0.001; (#) 0.10 ≥ p ≥ 0.05.
F and p values: (98) F(1,19) = 11.74, p = 0.003; (99) F(1,25) = 11.58, p = 0.002; (100) F(1,25) = 107.23, p < 10−10; (101) F(1,25) = 4.02, p = 0.056; (102) F(1,32) = 9.863, p = 0.004; (103) F(1,25) = 3.94, p = 0.058; (104) F(1,26) = 13.51, p = 0.001; (105) F(1,25) = 4.10, p = 0.054; (106) F(1,26) = 5.52, p = 0.027; (107) F(1,20) = 3.07, p = 0.095; (108) F(1,25) = 4.12, p = 0.053; (109) F(1,25) = 5.06, p = 0.033.
Parameter Main effects (two-way ANOVA) Group differences (from NaCl-Social) Treatment Rearing Interaction NaCl-Isolation MK801-Social MK801-Isolation PV+ neurons (Fig. 9) Amygdala Total — — #(110) n/a n/a n/a Central — — — n/a n/a n/a Lateral — — — n/a n/a n/a Basolateral — — ✓(111) — — — Basomedial — — ✓(112) — — ↑* PFC Total — — ✓(113) — — — IL — ✓(114) ✓(115) ↑* ↑** — PrL — — ✓(116) — — — PNNs (Fig. 9) Amygdala Total ✓(117) — ✓(118) — — — Central ✓(119) — — n/a n/a n/a Lateral — — — n/a n/a n/a Basolateral ✓(120) — ✓(121) — — — Basomedial #(122) ✓(123) — n/a n/a n/a PFC Total — — ✓(124) — ↑** — IL ✓(125) ✓(126) ✓(127) ↑* ↑*** — PrL — — — n/a n/a n/a PV-PNN colocalization (Fig. 9) Amygdala Total — ✓(128) ✓(129) — ↑# — Central — — — n/a n/a n/a Lateral — — — n/a n/a n/a Basolateral — — ✓(130) — — — Basomedial #(131) ✓(132) — n/a n/a n/a PFC Total — #(133) ✓(134) — ↑** ↓# IL ✓(135) ✓(136) ✓(137) — ↑*** — PrL — — — n/a n/a n/a ↵Symbols: (✓) statistically significant effect (two-way ANOVA); (—) no statistically significant effect (two-way ANOVA) or difference from NaCl-Social group (post hoc); (↑) increase; (n/a) not applicable; (↓) decrease; *p < 0.05; **p < 0.01; ***p < 0.001; #0.10 ≥ p ≥ 0.05.
F values and p values: (110) F(1,21) = 3.99, p = 0.059; (111) F(1,18) = 7.06, p = 0.016; (112) F(1,20) = 4.80, p = 0.041; (113) F(1,14) = 12.82, p = 0.003; (114) F(1,15) = 7.22, p = 0.017; (115) F(1,15) = 52.97, p = 3 × 10−6; (116) F(1,15) = 7.03, p = 0.018; (117) F(1,20) = 5.648, p = 0.028; (118) F(1,20) = 6.70, p = 0.016; (119) F(1,18) = 10.19, p = 0.005; (120) F(1,21) = 4.91, p = 0.038; (121) F(1,21) = 12.96, p = 0.002; (122) F(1,20) = 3.39, p = 0.08; (123) F(1,20) = 6.4, p = 0.02; (124) F(1,14) = 10.55, p = 0.006; (125) F(1,15) = 12.93, p = 0.003; (126) F(1,15) = 17.92, p = 0.001; (127) F(1,15) = 88.68, p < 10 − 7; (128) F(1,19) = 10.95, p = 0.004; (129) F(1,19) = 13.36, p = 0.002; (130) F(1,19) = 6.53, p = 0.019; (131) F(1,21) = 2.99, p = 0.098; (132) F(1,21) = 4.97, p = 0.037; (133) F(1,13) = 3.61, p = 0.08; (134) F(1,13) = 15.49, p = 0.002; (135) F(1,15) = 19.87, p = 4.61 × 10−4; (136) F(1,15) = 47.52, p = 5 × 10−6; (137) F(1,15) = 87.65, p < 10−7.
In this issue
