Article Figures & Data
Figures
- Fig. 1.
EphA receptor gene expression in the developing mouse raphe. A, qPCR of EphA3, EphA4, EphA5, EphA6, EphA7, and EphA8 mRNAs in DR extracts from P5 mice (n = 4 mice/experiment). Relative mRNA expression was calculated as 2–ΔCt (delta of cycle threshold). Data are presented as mean ± SEM from three independent experiments. B, In situ hybridization of SERT, EphA3, EphA4, EphA5, and EphA7 mRNAs is shown at three different rostro-caudal levels of the raphe nuclei, including DR (B7), caudal DR (B6), rostral MnR (B8), caudal MnR (B5), raphe pallidus (B1), obscurus (B2), and magnus (B3). Coronal serial sections (20 μm thick) were labeled with the five different probes. Localization of 5-HT neurons as revealed by SERT expression was outlined with dashed yellow lines that were transferred to the consecutive sections on the series. This shows that only EphA5 labeling coincides clearly with the contours of B7 and B8. EphA4 and EphA7 are also strongly expressed in the brainstem, but signal is mainly detected in cell groups such as the anterior tegmental nucleus (atg), the dorsal tegmental nucleus (dtg), or the inferior olive (io) that come very close to the raphe. Scale bar = 250 μm.
- Fig. 2.
EphA5 is expressed in serotonergic neurons during embryonic and postnatal development. A, qPCR of EphA5 mRNAs in DR extracts from P5 (n = 3), P15 (n = 3), and adult (n = 3). Relative mRNA expression was calculated as 2–ΔCt. Data are presented as mean ± SEM from three independent experiments, B, Time course of EphA5 expression in the developing raphe was analyzed on sagittal (E14) and coronal (P0, P5, P10, P15) sections through the raphe nuclei. Note the decrease in EphA5 expression by P15. No expression is detected using the sense probe of EphA5. Scale bar = 500 μm. C, Colocalization was visualized on confocal images after Tph2-immunostaining (green) and EphA5 ISH (red). Sagittal section of E14 mouse brain through the rostral (R) and caudal (C) raphe clusters that are indicated with arrows. Note that the dorsal part of the rostral cluster overlaps with EphA5 labeling, whereas the ventral part does not. C′, High-power image of the boxed area in A. Arrows indicate colocalized neurons (red nuclear labeling for EphA5 and green cytoplasmic labeling for Tph2); the asterisk shows Tph2+ neurons with no EphA5 expression. Scale bar = 1 mm (A), 100 μm (A′). D, E, F, Coronal sections of a P5 mouse hindbrain at rostral (B), intermediate (C) and caudal (C) levels of the raphe. Sections were counterstained with DAPI. Scale bar = 500 μm.
- Fig. 3.
Quantification of EphA5-Tph2 colocalization in distinct raphe nucleus. A–C, High-power confocal images in B7, B8, and B2, showing the difference in colocalization of EphA5 and Tph2 in different raphe nuclei. White arrows point to Tph2+EphA5 colocalized neurons; arrowheads show neuron containing only EphA5. Scale bar = 50 μm. D, E, Histograms summarizing the percentage colocalization among the different raphe nuclei, subdivided as the B1–B9 cell groups (D) and within the DR, where colocalization was compared at three rostro-caudal levels, caudal DR DR-C), middle DR (DR-M), rostral DR (DR-R), and three DR subdivisions, DR lateral (DR-L), DR dorsal (DR-D), and DR ventral (DR-V). Data are presented as mean ± SEM (n = 3). One-way ANOVA, ***p < 0.005 and ****p < 0.001.
- Fig. 4.
EphrinA5 induces collapse of rostral raphe serotonin axons in vitro. A, Explant preparation: hindbrain was dissected as an open book from E12 embryos; the rostral and caudal raphe were dissected as depicted on a whole-mount E12 hindbrain stained for 5-HT. Scale bar = 2 mm. B, Raphe explants (3DIV) were stained for 5-HT (green) and phalloidin (red). B1, 5-HT+ axons emerging from the explant. B2–B5, 5-HT–labeled growth cones displaying either a normal fan-like morphology (B2, B3) or collapsed growth cone with branch-like morphology (B4) or a long trailing process and an actin-rich retraction bulb. Scale bar = 100 μm (B1), 10 μm (B2–B5). C–F, Histograms show the percentage of collapsed growth cones when explants are exposed to different concentrations of ephrinA5. C, D, 5-HT–labeled axons from rostral (C) and caudal (D) explants; E, F, non–5-HT axons from rostral (E) and caudal (F) explants (>5 explants and >100 growth cones per condition). Data are presented as mean ± SEM. One-way ANOVA, *p < 0.05, **p < 0.01, ***p < 0.005, and ****p < 0.001.
- Fig. 5.
Overexpression of ephrinA3 downregulates serotonergic innervation in the amygdala and piriform cortex. A–B″, Electroporated neurons were revealed by TdTomato with the ephrinA3 plasmid in the targets of Am (A) and Pir (B). Corresponding 5-HT immunocytochemistry from the electroporated (A′, B′) and nonelectroporated (A″, B″) sides. Note the decrease of 5-HT fibers in the outlined area compared with control side. Scale bar = 100 μm. C, Target of electroporation (TdTomato) on a coronal section of P5 mouse brain at the level of amygdala. Arrows show electroporated Am and Pir. Scale bar = 1000 μm. D, E, Scattergram shows serotonergic fiber density in the electroporated (red) versus nonelectroporated (blue) amygdala (D) and piriform cortex (E). Overexpression of ephrinA3 resulted in a significant decrease of 5-HT fiber density compared with control groups (n = 5). Data are presented as mean ± SEM. Paired t test was used for ipsilateral vs. contralateral, ***p < 0.005.
- Fig. 6.
Anterograde tracing from dorsal raphe to olfactory bulb in ephrinA5–/– mice. A, AAV-TdTomato virus was injected in the DR. Injection sites were checked with 5-HT immunohistochemistry on the coronal raphe sections, showing 5-HT and TdTomato labeling in the DR but not in the MnR (A). Scale bar = 500 μm (left), 50 μm (right). B, Scheme shows the extent of AAV transfection in the WT (n = 5) and ephrinA5 (n = 5) cases; the injection site was reconstructed for each case and drawn manually on representative coronal raphe sections (bregma: –4.60 mm) using a different color code for each case. C, Sagittal mouse brain scheme showing the projections from the DR and MnR to the olfactory bulb (OB) targeting the inner (GCL) or outer (GL) layers, respectively. C′, In situ hybridization of ephrinA5 (Efna5) mRNA on OB coronal section. A selective expression of ephrinA5 is observed in the mitral layer (ML). Scale bar = 250 μm. D–E′, Anterogradely labeled axons (TdTomato) and SERT+ fibers in the OB of WT (D, D′) and ephrinA5 KO mice (E, E′). Most of the TdTomato were colabeled with SERT. More colabeled fibers were detected in the EPL of ephrinA5–/– mice, compared with WT. Scale bar = 50 μm. F–H, Histograms show the fiber densities of anterogradely labeled and SERT-labeled axons. F, The density of TdTomato fibers was normalized by calculating the EPL/GCL fiber density ratio. The density of 5-HT axons was measured as linear density of SERT-labeled axons (fibers/μm) in the EPL (G) and CGL (H; ***p < 0.005).
- Fig. 7.
EphrinA5 expression modulates DR innervation in forebrain target. A, F, Expression of ephrinA5 (Efna5) in the ventromedial hypothalamus (VMH; A), and the suprachiasmatic nucleus (SCN; F) in coronal brain section of P5 mice. High levels of ephrinA5 were detected in the VL and DM part of VMH. Scale bar = 500 μm. B–B″, C–C″, G–G″, H–H″, Immunofluorescence images show SERT labeling and anterograde labeling of DR in adult in control (B–B″, G–G″) and ephrinA5 KO (C–C″, H–H″) mice. Few fibers were detected in VMH and SCN of the control cases, whereas labeled fibers were detected in larger amounts in the VMH and SCN of the ephrinA5 KO (see arrows to compare between pictures). Scale bar = 100 μm (B–C″), 50 μm (G–H″). D, E, I, J, Histograms show fiber densities anterogradely labeled and SERT+ axons. Fiber density was calculated as pixels per square micrometer, and data are presented as mean ± SEM. Unpaired t test, *p < 0.05, **p < 0.01, and ***p < 0.005.
- Fig. 8.
Summary diagram. This scheme shows the expression level of EphA5 in the different 5-HT raphe nuclei, indicated with different shades of green, the maximal being in the DR-V, and lowest in B1, B2. The projections of the DR 5-HT neurons to the amygdala and to the granular cell layer (GCL) of the olfactory bulb are indicated with solid lines. In the ephrinA5 knockout mice, additional projections to the ventromedial hypothalamus (VMH) and the external plexiform layer (EPL) are visible, indicated with dotted lines. High ephrinA5-expression in the mitral cell layer (ML) and VMH is indicated in orange.
Tables
Restriction enzyme Polymerase Probe Sense Antisense Sense Antisense EphA3 HindIII EcoRI T7 T3 EphA4 SacI/SacII XhoI/BamHI T7 T3 EphA5 Xbal BamHI T3 T7 EphA7 BamHI XhoI T7 SP6 Efna2 HindIII EcoRV SP6 T7 Efna3 XhoI BamhI T7 SP6 Efna5 HindIII XbaI T3 T7 Primer mRNA Variant 1 Product length Forward primer Reverse primer EphA3 NM_010140 116 TGCGGGACTGTAACAGCATT CGTGAACTGATGCTCTCGGA EphA4 NM_007936 90 GAGGCTCCTGTGTCAACAACT AGTTGCCAATGGGTACCAGC EphA5 NM_007937 98 TTGGCTGTTGACCAGTTGGA GTCCTCCAGGAAGGCTGTTG EphA6 NM_007938 90 ACTGAAATCCGTGAGGTGGG GACTGAGACCAGAGCGATGC EphA7 NM_010141 98 TCCTCCTTAGTCGAGGTCCG GCCACTCTCCTTCTGCACTG EphA8 NM_007939 95 CATTGCTTTCCGCACGTTCT TCCAGTAGGGTCGTTCACCA Line Data structure Type of test Power a, (Fig. 2A) Homoscedastic One-way ANOVA
Tukey’s multiple comparisons test0.7792 b1, (Fig. 3D) Homoscedastic One-way ANOVA
Tukey’s multiple comparisons test0.8335 b2, (Fig. 3E) Homoscedastic One-way ANOVA
Tukey’s multiple comparisons test0.7097 c1, (Fig. 4C) Homoscedastic One-way ANOVA
Tukey’s multiple comparisons test0.9714 c2, (Fig. 4D) Homoscedastic One-way ANOVA
Tukey’s multiple comparisons test0.9783 c3, (Fig. 4E) Homoscedastic One-way ANOVA
Tukey’s multiple comparisons test0.266 c4, (Fig. 4F) Homoscedastic One-way ANOVA
Tukey’s multiple comparisons test0.934 d1, (Fig. 5D) Homoscedastic Paired t test (two tailed) 1 d2, (Fig. 5E) Homoscedastic Paired t test (two tailed) 1 e1, (Fig. 6F) Homoscedastic Unpaired t test (two tailed) 1 e2, (Fig. 6G) Homoscedastic Unpaired t test (two tailed) 1 e3, (Fig. 6H) Homoscedastic Unpaired t test (two tailed) 0.052 f1, (Fig. 7D) Homoscedastic Unpaired t test (two tailed) 1 f2, (Fig. 7E) Homoscedastic Unpaired t test (two tailed) 1 g1, Fig. 7I Homoscedastic Unpaired t test (two tailed) 1 g2, Fig. 7J Homoscedastic Unpaired t test (two tailed) 1 Statistical calculations were done with GraphPad Prism 6. Powers of each experiment were calculated by an online power calculator: https://www.anzmtg.org/stats/PowerCalculator.
- Table 4.
Counts of Tph2-immunopositive and EphA5-expressing neurons and colocalized neurons in different raphe nuclei
Neuron B1 B2 B3 B5 B6 B7 B8 B9 Tph2+ 8.2 ± 0.9 2.8 ± 0.1 7.4 ± 0.9 5.1 ± 0.1 30.7 ± 1.9 11.2 ± 0.9 5 ± 0.4 7.3 ± 0.5 EphA5+ 19.3 ± 3.3 3.3 ± 1.7 2.9 ± 1.5 8.9 ± 0.2 41.2 ± 2.9 23.3 ± 2.2 18.9 ± 1.6 16.9 ± 0.8 Tph2+/EphA5+ 1.3 ± 0.2 0 0.1 ± 0.1 0.7 ± 0.1 11.5 ± 0.6 5.7 ± 0.4 1.1 ± 0.1 1.6 ± 0.2 Tph2 colocalized, % 16.4 ± 1 0 1.8 ± 1.9 14.3 ± 0.7 37.6 ± 1.6 50.5 ± 1.2 22.3 ± 0.2 22.3 ± 2.8 Data are mean cell numbers ± SEM/area obtained from counts done in three cases in ROI covering the different raphe nuclei (B1–B9) . All cells (validated by DAPI staining) immunolabeled for Tph2, for EphA5 and double-labeled for Tph2 and EhpA5 were counted in three different ROIs (dimension 0.225 mm2) for each structure and for each case and checked for colocalization. Percentage of the colabeled Tph2 neurons is indicated.
- Table 5.
Counts of Tph2-immunopositive and EphA5-expressing neurons and colocalized neurons in the dorsal raphe (B7; mean ± SEM, n = 3)
Neuron DR-LW DR-C DR-M DR-R DR-D DR-V Tph2+ 4.5 ± 0.6 17.8 ± 2.3 20.2 ± 1.6 21 ± 2 20.1 ± 2.1 17.9 ± 1.8 EphA5+ 20 ± 1.2 20.6 ± 3.6 38.3 ± 4.3 18.6 ± 3.1 32.8 ± 3.5 26.2 ± 4.5 Tph2+/EphA5+ 0.6 ± 0.1 7.4 ± 1.1 16.4 ± 1.4 11.3 ± 0.7 11.1 ± 1.4 12.7 ± 1.2 Tph2 colocalized, % 12.6% ± 1.5 41.5 ± 1.2 81.1 ± 1 44.4 ± 7.7 55.2 ± 1.4 70.9 ± 0.6
In this issue
