Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT

User menu

Search

  • Advanced search
eNeuro
eNeuro

Advanced Search

 

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT
PreviousNext
Research ArticleResearch Article: New Research, Disorders of the Nervous System

Loss of Neuronal Imp Contributes to Seizure Behavior through Syndecan Function

Paula R. Roy and Nichole Link
eNeuro 21 April 2025, 12 (5) ENEURO.0545-24.2025; https://doi.org/10.1523/ENEURO.0545-24.2025
Paula R. Roy
Department of Neurobiology, University of Utah, Salt Lake City, Utah 84112
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Paula R. Roy
Nichole Link
Department of Neurobiology, University of Utah, Salt Lake City, Utah 84112
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Abstract

Seizures affect a large proportion of the global population and occur due to abnormal neuronal activity in the brain. Unfortunately, widespread genetic and phenotypic heterogeneity contributes to insufficient treatment options. It is critical to identify the genetic underpinnings of how seizures occur to better understand seizure disorders and improve therapeutic development. We used the Drosophila melanogaster model to identify that IGF-II mRNA-binding protein (Imp) is linked to the onset of this phenotype. Specific reduction of Imp in neurons causes seizures after mechanical stimulation. Importantly, gross motor behavior is unaffected, showing Imp loss does not affect general neuronal activity. Developmental loss of Imp is sufficient to cause seizures in adults; thus, Imp-modulated neuron development affects mature neuronal function. Since Imp is an RNA-binding protein, we sought to identify the mRNA target that Imp regulates in neurons to ensure proper neuronal activity after mechanical stress. We find that the Imp protein binds Syndecan (Sdc) mRNA, and the reduction of Sdc also causes mechanically induced seizures. Expression of Sdc in Imp-deficient neurons rescues seizure defects, showing that Sdc is sufficient to restore normal behavior after mechanical stress. We suggest that the Imp protein binds Sdc mRNA in neurons, and this functional interaction is important for normal neuronal biology and animal behavior in a mechanically induced seizure model. Since Imp and Sdc are conserved, our work highlights a neuronal-specific pathway that might contribute to seizure disorder when mutated in humans.

  • Drosophila
  • neurogenetics
  • RNA-binding proteins
  • seizure

Significance Statement

Imp is a widely studied RNA-binding protein in neural stem cell function, but surprisingly little is known about how it functions in postmitotic neurons in any model system. Here, we show that loss of neuronal Imp impairs mature neuronal function. Moreover, since RNA-binding proteins potentially regulate many targets, we provide a specific mechanism that illuminates how Imp could maintain normal neuronal function through downstream target Syndecan. Syndecan functions in cell adhesion, growth factor receptor activation, and intercellular signaling. Loss of Imp, and as a result, Syndecan, could cause defects in neuron migration, growth, or synapse morphology which could significantly impact neuronal function. On a broader level, our work highlights an important pathway to investigate human brain development and disease.

Introduction

Seizure disorders are debilitating but common conditions. An estimated 10% of the human population will have at least one seizure in their life, and up to 3% of the global population experiences recurring spontaneous seizures defined as epilepsy (Shneker and Fountain, 2003). Despite their prevalence, phenotypic heterogeneity makes it challenging to identify seizure causality. Therefore, the development of patient-specific treatments can be difficult, but an understanding of the genetic pathways underlying seizure pathology may aid in the development of patient-directed therapies. Model organism research can greatly facilitate the identification of genetic-based seizure disorders (Tapia et al., 2021; Fischer et al., 2023). Genetic pathways can be studied in detail, mechanisms of pathogenesis are often uncovered, and drugs can be screened in a patient-specific manner to identify candidate therapeutics.

A class of genes with a growing connection to syndromes involving seizures are RNA-binding proteins (Schieweck et al., 2021). Therefore, the contribution of RNA-binding proteins in neurodevelopment and neurological disease is an emerging interest in the fields of genetics and neuroscience. RNA-binding proteins spatially and temporally regulate gene expression to coordinate and modify dynamic cellular networks like those found in the brain (Prashad and Gopal, 2021; Parra and Johnston, 2022). Insulin growth factor 2 binding proteins (IGF2BPs) are mRNA-binding proteins that post-transcriptionally regulate mRNA by influencing localization, transport, translation, and stability (Nielsen et al., 2001; Yaniv and Yisraeli, 2002). Vertebrates have three IGF2BP paralogs (1–3) that are expressed during development, with high expression in neuronal cells (Conway et al., 2016; Degrauwe et al., 2016). Though there is no current functional validation of IGF2BPs to specific neuropathologies, IGF2BP3 is a primary microcephaly candidate (Duerinckx et al., 2021), and all IGF2BPs are associated with multiple targets connected to autism spectrum disorder (Pintacuda et al., 2023). There is also much model organism evidence to support the critical role of IGF2BPs in brain development. IGF2BP1 influences pluripotent stem cell adhesion and survival (Conway et al., 2016; Degrauwe et al., 2016), neural stem cell maintenance (Nishino et al., 2013), hippocampal dendrite arborization (Perycz et al., 2011), and axon guidance and outgrowth (Gaynes et al., 2015; Lepelletier et al., 2017). IGF2BP2 localizes in dendrites (Tiruchinapalli et al., 2003) and in neural precursors, where it mediates neurogenic and astrocyte differentiation potential (Fujii et al., 2013). The single ortholog in Drosophila (Imp) is structurally conserved with vertebrate IGF2BPs (Hansen et al., 2015) and is a well-documented temporal factor in neural stem cells, where it is expressed in a high to low gradient starting in embryogenesis (Adolph et al., 2009). Descending Imp levels through the larval stage defines stem cell growth and proliferation (Yang et al., 2017; Samuels et al., 2020), neuronal fate and diversity (Ren et al., 2017; Yang et al., 2017; Munroe et al., 2022), and stem cell decommissioning (Yang et al., 2017; Samuels et al., 2020). Specifically, Imp promotes Chinmo translation and consequently represses mamo transcription (Liu et al., 2015) to control the specification of early and late-born neurons (Liu et al., 2015). Imp also controls the growth and proliferation of neural stem cells by stabilizing Myc transcripts (Samuels et al., 2020) and localizes to axons suspected to regulate regrowth during axon remodeling via prolifin mRNA transport and localization (Medioni et al., 2014). In both stem cells and intermediate neural progenitors, Imp facilitates proper neuropil targeting to the major learning and memory centers in the adult brain (Munroe and Doe, 2023) and is required for proper development of adult olfactory navigation circuitry (Hamid et al., 2023). Together, these studies show that Imp function in neural stem cells during development affects both neuronal morphology (Medioni et al., 2014; Vijayakumar et al., 2019) and neuronal fate (Liu et al., 2015; Munroe and Doe, 2023; Guan et al., 2024) in adults.

While previous work highlights the critical role that IGF2BPs/Imp have on neurodevelopment, research to date has primarily focused on neural stem cells or intermediate neural progenitors. Furthermore, the functional consequences of developmental Imp loss are vastly understudied. This leads us to ask: how does Imp regulate neurons both developmentally and functionally, and how does disruption of Imp in these neurons correlate to human neuropathologies? We hypothesize that Imp is required in neurons themselves for normal neuronal function, and to test this hypothesis, we leveraged the Drosophila model system to spatially and temporally knock down Imp expression. We found that neuronal Imp is required during development to ensure proper neuronal function that is specific to seizure behavior. We also found a smaller role for Imp independent of development, because the loss of Imp in adulthood caused seizures. We also identified that loss of Imp target, Syndecan (Sdc), caused seizures and showed with rescue assays that Sdc functionally interacts with Imp in seizure behavior. Together, we show that neuronal Imp is essential in developing neurons for adult neuronal function and that the interaction between Imp and Sdc modulates seizure behavior.

Materials and Methods

Drosophila melanogaster strains and culture

The following lines were used in this study with genotypes separated by commas: w[*]; P{w[ + mW.hs] = GawB}insc[Mz1407] (RRID: BDSC_8751), y[1] w[1118]; P{y[ + t7.7] w[ + mC] = nSyb-GAL4.P}attP2 (RRID: BDSC_51941), y[1]sc[*] v[1] sev [21]; P{y[ + t7.7] v[ + t1.8] = VALIUM22-EGFP.RNAi.1}attP40 (RRID: BDSC_41557), y[1]sc[*] v[1] sev [21]; P{y[ + t7.7] v[ + t1.8] = TRIP.HMC03794}attP40 (RRID: BDSC_55645), P{KK108799}VIE-260B (RRID:Flybase_FBst0479142), w[*]; P{w[ + mC] = UAS-Sdc.J}3 (RRID: BDSC_8564), P{UAS-t, y[1]w[*] Mi{PT-GFSTF.2}Imp{M105901-GFSTF.2 (RRID: BDSC_60237), y[1] w[*]; Mi{PT-GFSTF.0}Sdc[MI10787-GFSTF.0]/Cyo (RRID: BDSC_66373).

All lines were maintained at either 25 or 18°C on Archon Scientific glucose medium supplemented with dry yeast in wide plastic vials. All incubators were kept on a 12 h light/dark cycle.

Behavior assays

Standard behavior conditions

All flies were aged to 14 d. Crosses were set by placing 10 virgin GAL4 driver females into a single vial with five UAS males. A minimum of three replicate vials per experimental group were set, and for each individual, the vial identification was tracked to ensure that there were no cross/vial effects. Carbon dioxide can acutely alter behavior (Bartholomew et al., 2015), so flies were only anesthetized with carbon dioxide when collected as virgins and later moved into test vials using mouth pipetting. After transferring to a new vial, animals were left to acclimate for 20 min at room temperature. All behavior trials were performed within 4 h of lights on. Females exhibited a more consistent phenotype in Imp pilot seizure assays (Extended Data Fig. 1-1), so only females were used for data collection. All trials were recorded using either an iPhone 13 mini or a Panasonic DMC-G85 camera with an Olympus ED 60 mm f2.8 macro lens.

Seizure assays

Female progeny from each experimental genotype were matched to the same driver control knockdown (eGFP) and aged at 29°C. Standard bang sensitivity assays, specifically vortex assays, were performed to assess seizure behavior (Fischer et al., 2023) where vials were vortexed for 10 s and placed on the bench at eye level to easily record flies. The proportion of flies seizing and time to recovery were recorded for each vial. Seizing was defined by supine paralysis, spastic movement, and/or inability to walk with excessive tremoring. Recovery was defined as walking normally in the correct orientation without abdominal or wing spasms and/or exhibiting normal geotaxis behavior without abdominal/wing spasms or falling. Some flies climbed very quickly after flipping over and did not walk along the bottom of the vial. Trials were ended once all flies had recovered fully or until 60 s.

Developmental/functional assays

Imp RNAi crosses were set, and progeny developed (egg, larval, and pupal stages, then up to 4 h post-eclosion), at either 18°C (low GAL4 activity temperature) or 29°C (high GAL4 activity temperature). Within 4 h of eclosion, adults were collected and moved into fresh vials and either left at their developmental temperature or moved to the inverse temperature to age for 14 d. On the assay day, aged flies were aspirated into empty vials in sets of up to 15 and acclimated for 20 min at room temperature. Flies were analyzed for seizure using the standard bang assay described in the initial knockdown assays.

Rescue assays

Female progeny were collected within 8 h of eclosion and aged to 14 d at 29°C. On seizure assay days, aged flies were aspirated into empty vials in sets of up to 10 and acclimated for 20 min at room temperature. Flies were analyzed for seizure using the standard bang assay described in the initial seizure assays.

Forced-climbing assays

Female progeny were developed and aged to 14 d at 29°C. On the day of testing, aged female flies were aspirated into empty vials marked with 1 cm lines in sets of up to 10 and acclimated for 20 min at room temperature. Vials were banged on the benchtop three times to ensure that all flies were at the vial bottom and were allowed 60 s to climb to their maximum distance (up to 9 cm). The maximum distance climbed by each fly was recorded.

Quantitative PCR

Brains from late third-instar larvae (three biological replicates of 10 brains for each genotype) were dissected in RNAse-free PBS, rinsed in RNAse-free water, flash frozen on dry ice, and stored at −80°C. Total RNA was isolated using standard TRIzol extraction (Green and Sambrook, 2020), synthesized into cDNA (iScript cDNA synthesis, Bio-Rad #1708890), and stored at −20°C. Primer sequences for Imp: (F) CGTCACGCGCTGCAATTC (R) GCTTCATGTGTGGCACGGAC. Primer sequences for Rp49/RpL32: (F) ATGACCATCCGCCCAGCATACA (R) CGTAACCGATGTTGGGCATCAGATACT. Primers were optimized with nonquanitative fast-run PCR (PowerTrack SYBR Green Master Mix, Applied Biosystems #46012) with a temperature gradient (55–65°C) to determine the best annealing temperature. Quantitative PCR was performed on a Life Technologies QuantStudio 12 K Flex instrument at the University of Utah Genomics Core Facility. Rp49/RpL32 was used to normalize Imp knockdown levels.

RNA immunoprecipitation

Forty yw (control) and y[1]w[*] Mi{PT-GFSTF.2}Imp{M105901-GFSTF.2 (RRID: BDSC_60237) larvae were collected, fixed in 0.1% paraformaldehyde (EM grade, Electron Microscopy Sciences #15710) in 1× phosphate-buffered saline (PBS) plus 0.3% Triton X-100 for 10 min. From here, all steps were carried out in an RNAse-free manner with RNAse inhibitors if needed. Larvae were rinsed with 0.125 M glycine to stop fixation, rinsed in PBS, and transferred to Chaps cell extract buffer (Cell Signaling Technology #9852) with Pierce phosphatase and protease inhibitors (Thermo Fisher Scientific #A32961) or Halt protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific #78440). Animals were ground with a motorized pestle, frozen at −80°C, thawed on ice, and vortexed three times. Debris was pelleted by centrifuging for 10 min at 4°C. Supernatant was transferred to a new tube. Fifty microliters were saved for RNA and protein input samples. A Chromotek GFP-Trap Agarose kit was used to immunoprecipitate Imp-GFP and wash the sample. Fifty microliters of lysate flow were saved for RNA and protein analysis. One-third of immunoprecipitate was saved for protein analysis. To disassociate RNA from Imp-GFP/beads, GFP agarose was resuspended in 100 µl lysis buffer (from the Chromotek kit) with 30 µg proteinase K and incubated for 30 min at 55°C in a thermoshaker with agitation. RNA was extracted using TRIzol (Thermo Fisher Scientific #15596026). Six hundred microliters of TRIzol were added, mixed by pipetting up and down, and incubated at room temperature for 5 min. One hundred and fifty microliters of chloroform were added, tubes were shaken vigorously for 15 s, and samples were incubated for 10 min at room temperature. Tubes were centrifuged for 15 min at 4°C, and the aqueous phase was removed and saved. Subsequently, 1.5 µl of GlycoBlue and 500 µl of isopropanol were added and tubes were vortexed for 10 s. Samples were incubated overnight at −20°C and centrifuged for 15 min at 4°C for precipitation. RNA pellets were washed with 70% ethanol, and dried pellets were resuspended in 20 µl of RNAse-free water. cDNA was generated using a Bio-Rad iScript cDNA synthesis kit (Bio-Rad #1708890). Primers specific for Sdc were used for PCR (forward: TCCTACGGCCATAGCCATTAT; reverse: CGGTAGAAGTAATTCCGCCAGA).

Larval dissection and immunohistochemistry

Brains from late third-instar larvae (identified by gut clearing and spiracle protrusion) were dissected in cold phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde in PBS plus 0.3% Triton X-200 (PBST) for 20 min, then washed in PBST for 5 min three times before blocking in PBST plus 1% bovine serum (PBSTB) for 30 min two times. Brains were blocked a third time in PBSTB plus 5% normal donkey serum (NDS) for 30 min. Brains were incubated in primary antibodies diluted in PBSTB for 3 d at 4°C, washed with PBSTB for 20 min three times, and then incubated in secondary for 2 d at 4°C. Brains were washed in PBST four times for 15 min, adding DAPI into the second wash, and mounted in SlowFade gold on microscope slides with spacers made from a single layer of double-sided tape.

We used the following antibodies in this study: rabbit anti-GFP (1:1,000, Invitrogen A-11122, RRID: AB_221569), rat anti-Imp (1:200, a gift from Dr. Claude Desplan, New York University), mouse-anti ElaV (1:100, Developmental Studies Hybridoma Bank 9F8A9, RRID: AB_2314364), donkey anti-rabbit 488 (1:500, Jackson ImmunoResearch 711-545-152, RRID: AB_2313584), donkey anti-rat fluorophore 647 (1:500, Jackson ImmunoResearch 712-605-153, RRID: AB_2340694), and donkey anti-mouse fluorophore rhodamine red-X secondary (1:500, Jackson ImmunoResearch 715-295-151, RRID: AB_2340832).

Brains were imaged on a Zeiss LSM980 confocal microscope using Airyscan. Single 2 um slices through the middle of the brain were imaged with a 63× oil objective.

Statistics

For seizure assays, the total time to recovery was analyzed between control and treatment groups using a Mann–Whitney U test for single comparisons and a Kruskall–Wallis test for multiple comparisons. For motor assays, the maximum distance climbed was analyzed between control and treatment groups with a Mann–Whitney U single-comparison test. We chose nonparametric tests because the variation in behavior within genotypes follows non-normal distributions. All statistical analyses were performed using GraphPad Prism version 10.0 for Mac OS, GraphPad Software, Boston, MA, USA, www.graphpadprism.com. Minimum N size was determined using seizure data from our pilot neural stem cell and postmitotic knockdown experiments to perform an a priori sample size computation in G*Power (Faul et al., 2007) using α = 0.5 and a power set to 0.80. The threshold for sufficient power was N = 40. The power of each test was determined using post hoc analysis in G*Power (Faul et al., 2007) using α = 0.5 and power set to 0.80 (Table 1).

View this table:
  • View inline
  • View popup
Table 1.

Power analysis results for all behavioral assays determined post hoc in G*Power

Results

Loss of Imp causes seizures with normal gross motor function

Imp has been highly characterized in neural stem cells where it functions as an important temporal factor to influence the type of neurons produced at different developmental time points (Liu et al., 2015). However, it is unknown how loss of neuronal Imp might affect brain function independent from its role in stem cells. To test Imp's neuronal function and resulting behavior outputs, we assessed seizure phenotypes using vortex assays. We reduced Imp using in vivo RNA interference (RNAi) in two primary cell types: neural stem cells and postmitotic neurons. Loss of Imp in both cell types resulted in some animals seizing, but only neuronal knockdown animals seized significantly more than controls [Fig. 1A, Kruskal–Wallis, p > 0.999 (neural stem cells) and p < 0.0001 (neurons)]. Loss in postmitotic neurons caused both a higher frequency of seizures and a trend of longer recovery from seizures (Fig. 1B). The average length of seizure was 9.67 s in animals with Imp knockdown in neural stem cells. However, Imp knockdown in neurons caused seizures for an average of 22.38 s, correlating neuronal Imp loss to a more severe phenotype (Kuebler and Tanouye, 2002). The difference in recovery time between stem cell and neuronal Imp knockdown was significantly different (Kruskal–Wallis, p < 0.0001, Fig. 1A). All neural stem cell knockdown animals recovered in under 10 s, and once animals recovered, they did not experience additional seizures (Movies 1 and 2). Neuronal knockdown animals had a more conspicuous phenotype. Noticeable “tonic–clonic” phases with paralysis were interrupted by multiple bouts of spasms during the recovery phase (Fischer et al., 2023). Individuals experiencing multiple episodes demonstrated periods of flips, brief walks, and a return to supine position, which corresponded to “clonus-like” activity (Movies 3 and 4). Neuronal knockdown produced a robust and consistent seizure phenotype, supporting the idea that neuronal Imp regulates neuron function in the context of seizure behavior. Furthermore, this function was not dependent on Imp's role in neural stem cells. As a result, the remainder of the analyses were performed only on neuronal knockdown animals.

Figure 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1.

Imp knockdown causes higher occurrence and longer duration of seizures with normal gross motor function. A, Seizure behavior reported as average time to recover after vortexing for eGFP RNAi control (VALIUM22-EGFP.shRNAI.1) and Imp RNAi (TRIP.HMC03794) expressed using neural stem cell driver inscuteable-GAL4 (insc-GAL4) or pan-neuronal driver neuronal synaptobrevin-GAL4 (nSyb-GAL4). Individual points represent each fly, whiskers represent 95% confidence intervals, and bar heights equal the mean. Kruskal–Wallis test determined the significance between all conditions. Relevant comparisons reported (p < 0.05, ***p < 0.01, ***p < 0.001,****p < 0.0001, ns = p > 0.05). N, number of total animals. B, Percentage of flies seizing reported in A observed at 5 s intervals across the entire 60 s trial. Ns are the same as in A. Seizing is defined by supine paralysis, spastic movement, and/or inability to walk with excessive tremoring. Behavioral assays were performed on Day 14. C, Maximum distance climbed (cm) in 30 s for eGFP RNAi control and Imp RNAi expressed in nSyb-GAL4. Individual points represent individual flies, whiskers represent 95% confidence intervals, and bar heights equal the mean. p-values are reported above each bar. Mann–Whitney U determined significance (p < 0.05, ***p < 0.01, ***p < 0.001,****p < 0.0001, ns = p > 0.05). N, number of total animals. All animals were female because their seizure phenotypes were more consistent (Extended Data Fig. 1-1).

Figure 1-1

Imp knockdown has a stronger effect on females. Seizure behavior reported as average time to recover after vortexing for eGFP RNAi (VALIUM22-EGFP.shRNAI.1) Control and Imp RNAi (TRIP.HMC03794) expressed using pan-neuronal driver neuronal synaptobrevin-GAL4 (nSyb-GAL4). Individual points represent each fly, whiskers represent 95% confidence intervals, and bar heights equal the mean. Kruskal-Wallis test determined significance between all conditions. Relevant comparisons reported (p<0.05, ***p<0.01, ***p<0.001,****p<0.0001, ns=p>0.05). N= number of total animals. Download Figure 1-1, TIF file.

Flies have a natural tendency to climb that is inhibited if animals are experiencing gross motor defects (Cao et al., 2017). Climbing deficiencies in Imp knockdown animals could suggest a general motor deficit rather than a specific functional defect. To differentiate between gross deficits and acute, induced functional disruptions, we used forced-climbing assays. Aged flies were placed into vials, banged to the bottom, and allowed to climb to a maximum distance (9 mm) for 60 s to determine if animals had any broad motor deficits that prevented climbing. We found that loss of neuronal Imp did not affect climbing ability (Mann–Whitney U, p = 0.3931, Fig. 1C), suggesting that the observed mechanically induced seizure phenotypes were not due to gross motor problems. Therefore, neuronal Imp functions in seizures but not general motor function.

Developmental Imp loss is the primary contributor to seizure behavior

RNA-binding proteins are broadly acting genes affecting both cell development and mature cell function (Prashad and Gopal, 2021; Chan et al., 2022; Parra and Johnston, 2022). To determine when Imp loss results in seizures, we used the GAL4-UAS system to temporally remove Imp in neurons. Some GAL4-UAS combinations have a temperature-sensitive effect where strong activity occurs at high temperatures (high activity, 29°C) and little-to-no activity occurs at low temperatures (low activity, 18°C). We verified phenotype-specific temperature sensitivity by comparing recovery times in vortex assays between control and Imp knockdown animals at high activity and low activity conditions (Fig. 2A). We found a significantly longer recovery time using the high activity conditions (29°C, Kruskal–Wallis p < 0.0001) but not the low activity conditions (18°C, p = 0.0765), showing that nSyb-GAL4 combined with our Imp RNAi construct has a temperature-sensitive phenotype that can be used to modulate the severity of Imp knockdown. Additionally, we validated Imp knockdown at both high and low activity temperatures using quantitative PCR (Fig. 2B) and found an average decrease in Imp expression by 84% at 29°C but no decrease in expression at 18°C. We used this temperature-sensitive phenotype to disentangle Imp function during development versus in the adult (Fig. 2A). We placed developing animals in the low activity condition (18°C) and moved adults to the high activity condition (29°C) upon eclosion. Our schedule was designed to isolate Imp knockdown to adulthood only. Seizure activity increased in animals with Imp knockdown only during adulthood, but it was not significantly different from its eGFP RNAi control match (Kruskal–Wallis, p > 0.9999). Next, we placed developing animals in the high activity condition (29°C) during development and upon eclosion moved adults to the low activity condition (18°C). This time, our schedule was designed to isolate Imp knockdown to development only. Developmental Imp knockdown caused significantly longer recovery times when compared with eGFP RNAi knockdown controls (Kruskal–Wallis p < 0.0001). Developmental Imp and adult Imp knockdown group recovery times were significantly different from each other with the average developmental Imp recovery time (15.59 s) approximately twice as long as adult Imp knockdown (6.738 s, Kruskall–Wallis p = 0.0070). There was also a much higher proportion of individuals seizing in the developmental knockdown group compared with the adult knockdown group (Fig. 2C). Our results suggest that Imp functions primarily in development to regulate seizures. In addition, developmental Imp knockdown (from 29 to 18°C) closely phenocopies continual knockdown (maintained at 29°C) phenotypes. Together, these results suggest that developmental Imp expression plays the most critical role in programming future neural function, but both developmental and adult Imp expression could contribute to neuronal function important for seizure regulation.

Figure 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2.

Developmental loss of neuronal Imp is the primary source of seizure behavior. A, Average time to recover for flies exhibiting seizure behavior for neuronal (nSyb-GAL4) eGFP RNAi (control) and neuronal Imp RNAi. High GAL4 activity animals are raised at 29°C and low GAL4 activity animals are raised at 18°C. Results demonstrate that nSyb-GAL4 RNAi is temperature sensitive. Developmental knockdown animals are raised at 29°C and moved to 18°C within 1 d of adulthood. Adult knockdown animals developed at 18°C and shifted to 29°C within 4 h of adulthood. Behavioral assays were performed on Day 14. Individual points represent individual flies, whiskers represent 95% confidence intervals, and bar heights equal the mean. p-values are reported above each bar. Kruskal–Wallis determined significance between all conditions. N, number of total animals. Relevant comparisons reported (p < 0.05, ***p < 0.01, ***p < 0.001,****p < 0.0001, ns = p > 0.05). Developmental knockdown of Imp is sufficient to recapitulate the seizure phenotype. B, Fold change in Imp expression in third-instar larval brains developed at 18 and 29°C. Individual points represent a biological replicate group of 10 larval brains, whiskers represent 95% confidence intervals, and bar heights equal the mean. C, Percentage of flies presented in A, seizing observed at 5 s intervals across the entire 60 s trial.

The Imp downstream target Sdc is required for normal neuronal function and interacts with Imp molecularly and functionally

Since Imp is an RNA-binding protein, Imp's downstream target genes must be identified to molecularly understand Imp's control of seizures. Samuels et al. (2020) isolated mRNAs that bound to the Imp protein in third-instar larval brains. We leveraged this list of potential Imp mRNA targets to identify relevant candidates in seizure behavior using RNAi and vortex assays. Sdc knockdown was particularly interesting because it had a significantly longer recovery time compared with controls (average recovery time 18.16 s, Fig. 3A, Mann–Whitney U p < 0.0001) and exhibited robust tonic–clonic episodes after vortexing (Movie 5), suggesting that Sdc also is required to properly regulate seizure behavior.

Figure 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3.

Sdc interacts with Imp molecularly and functionally and is required for normal neuronal function. A, Average time to recover for flies exhibiting seizure behavior for neuronal (nSyb-GAL4) eGFP RNAi (control) and neuronal Sdc RNAi. Individual points represent each fly and whiskers represent 95% confidence intervals. N, number of total animals. Mann–Whitney U determined significance (p < 0.05, ***p < 0.01, ***p < 0.001,****p < 0.0001, ns = p > 0.05). B, Maximum distance climbed (cm) in 30 s for eGFP RNAi control and Sdc RNAi. Mann–Whitney U significance (*p < 0.05, ***p < 0.01, ***p < 0.001,****p < 0.0001, ns = p > 0.05). C, RNA immunoprecipitation of Imp-GFP protein from control (yw) and Imp-GFP animals using nanobody GFP agarose. Imp is immunoprecipitated specifically in Imp-GFP animals. D, PCR analysis of Imp-GFP RNA immunoprecipitation using primers specific to Sdc in control (yw) and Imp-GFP animals. Sdc product is amplified in Imp-GFP RIP but not in control RIP (yw). E–H, Confocal images of a single slice through the central brain of a third-instar larva stained with ElaV (neurons, cyan), Imp (magenta), and endogenous Sdc-GFP (green). Imp and Sdc proteins are both present in neurons. I, Average time to recover after vortexing for flies exhibiting seizure behavior for neuronal expression (nSyb-GAL4) for eGFP RNAi (control), Imp RNAi, Imp RNAi + UAS-luciferase (dilution effect control), and Imp RNAi + UAS-Sdc cDNA. Points represent individual flies, whiskers represent 95% confidence intervals, and bar heights equal the mean. p-values are reported above each bar. N, number of total animals. Kruskal–Wallis determined significance between all conditions, relevant comparisons reported (p < 0.05, ***p < 0.01, ***p < 0.001,****p < 0.0001, ns = p > 0.05). J, Percentage of flies seizing presented in (E) observed at 5 s intervals across the entire 60 s trial. Expression of Sdc cDNA in Imp knockdown animals rescues seizure deficits.

Movie 1.

Normal baseline recovery from vortexing in neural stem cell knockdown in control animals (eGFP RNAi). [View online]

Movie 2.

Slight impairment but relatively quick recovery from vortexing for animals when Imp is knocked down in neural stem cells. [View online]

Movie 3.

Normal baseline recovery from vortexing in pan-neuronal knockdown in control animals (eGFP RNAi). [View online]

Movie 4.

Impairment in recovery from vortexing for animals with Imp knocked down pan-neuronally, with visible tonic–clonic episodes. [View online]

Movie 5.

Impairment in recovery from vortexing for animals with Sdc knocked down pan-neuronally, with visible tonic–clonic episodes. [View online]

Movie 6.

Recovery from vortexing in animals with Sdc cDNA expression in Imp pan-neuronal knockdown background, with fewer seizing animals and relatively quick recovery. [View online]

Sdc encodes a heparan sulfate proteoglycan that regulates midline axon guidance during development (Johnson et al., 2006) and the development of the neuromuscular junction (Nguyen et al., 2016), indicating that it could also function in gross motor behavior. However, the strongest candidate for downstream target analysis would cause seizure-specific deficiencies, but not gross motor deficits. To ensure we chose a strong candidate and ruled out broad motor defects, we performed forced-climbing assays on Sdc neuronal knockdown animals. Like Imp, Sdc knockdown did not cause any gross motor defects (Fig. 3B, Mann–Whitney U p = 0.9961). Therefore, Sdc is a strong candidate for seizure regulation. If Sdc mRNA is a target of Imp, Imp protein should bind Sdc mRNA. We performed RNA immunoprecipitation (RIP) in third-instar larval brains using Imp-GFP animals and anti-GFP agarose to validate that Imp binds to Sdc mRNA. Western analysis of RIP samples showed Imp-GFP is sufficiently immunoprecipitated (Fig. 3C). In addition, we found a signal for Sdc in Imp-GFP pulldowns, but not when using a control fly line that does not contain GFP (Fig. 3D, yw). These data suggest a strong and specific physical interaction between Imp and Sdc mRNA. Next, we identified whether Imp and Sdc were coexpressed in neurons in the brain. We immunostained third-instar larval brains for Imp, Sdc (using an endogenously tagged Sdc-GFP), and Elav (to mark neurons). We found that Imp and Sdc coexpress in central brain neurons (Fig. 3E–H). Coexpression of proteins in neurons supports a relevant functional interaction, and our data indicate that together, Imp and Sdc regulate neuronal function.

Physical interaction between Imp protein and Sdc mRNA combined with coexpression in relevant cell types is highly suggestive of a functional relationship. However, to conclude that the observed interaction is biologically relevant to our phenotype of interest, we tested whether Sdc overexpression could rescue Imp-induced seizures. We quantified phenotypic rescue in flies expressing Sdc cDNA while simultaneously knocking down Imp in neurons to identify such relevant interactions. Sdc cDNA expression significantly reduced the time needed to recover from vortexing in Imp knockdown animals (average time to recover, 2.83 s) compared with Imp knockdown alone (average time to recover, 10.79 s; Kruskal–Wallis p = 0.0004; Fig. 3I). In addition, the percentage of flies seizing was reduced to near control levels (Fig. 3J), and tonic–clonic episodes were nearly absent (Movie 6). Our data indicate complete rescue of seizure deficits and strongly suggest that Imp regulates Sdc mRNA in the context of neuronal function and seizure behavior.

Discussion

Identifying genes that contribute to seizure disorders is an important first step in understanding how they arise and can best be treated. In this study, we demonstrate that Imp and its downstream target Sdc are required in neurons for seizure behavior regulation. Our study is one of few studies that has linked developmental Imp to adult behaviors (Hamid et al., 2024) and highlights the critical role of both Imp and Sdc in postmitotic neuronal development. We can now tease apart the critical developmental pathways through which Imp regulates proper neuronal function.

To identify the nature of how seizures are caused, it is important to investigate the contribution of individual cell types during development. Imp function in neural stem cells is consequential to many neurodevelopmental outcomes, but not seizure phenotypes. Interestingly, our results suggest that Imp expression in postmitotic neurons is most critical to prevent seizures; loss of Imp in neural stem cells only has no significant effect on adult neuronal function. Because little is known about the role of Imp in neurons, how Imp regulates development and function in the context of the terminally fated cell is an open question. We can, however, gain insight from our findings. Imp binds Sdc mRNA, and Sdc phenocopies Imp seizure phenotypes. These data suggest that Imp disruption directly impacts Sdc-specific phenotypes to cause seizures. Sdc is a conserved transmembrane heparan sulfate proteoglycan (Spring et al., 1994) that is secreted from midline cells of the fly central nervous system and binds products that mediate axon guidance (Nguyen et al., 2016). Sdc also promotes synapse growth at the neuromuscular junction (Johnson et al., 2006). Given that loss of both Imp and Sdc cause seizure phenotypes, we posit that Imp expression is required for proper neuronal growth because it regulates Sdc expression. Modifications in neural structure, particularly dendritic length and/or branching pattern, can change its firing pattern (van Elburg and van Ooyen, 2010). A vertebrate paralog of Sdc (Syndecan-2) promotes the formation of dendritic spines, and so would be interesting to test Syndecan-2's role in neuronal activity and seizure phenotypes. Sdc's role at the neuromuscular junction is postsynaptic (Nguyen et al., 2016), so it is possible that Imp influences dendrite growth required for proper neuronal function via Sdc expression levels. Alternatively, loss of Imp and/or Sdc in postmitotic neurons could disrupt cell survival and induce loss of neurons. Neuronal loss has been linked to asynchronization and tonic depolarization leading to seizures (Chauhan et al., 2022). Whether loss of Imp causes supernumerary neuron cell death that leads to seizures and whether Sdc overexpression could rescue this phenotype are intriguing and an essential future study.

Though Imp has been studied extensively in a developmental context, our data suggest that Imp plays a potential role in adult neuronal maintenance and function. This study sought to determine when Imp function was required for seizure regulation. Our results strongly suggest that developmental Imp has the most influence on neuronal function later in life. However, flies with reduced Imp only in adulthood still experienced a marked increase in seizures, though not statistically significant, while loss of developmental Imp caused more severe seizures with a significant increase in duration and a higher likelihood of occurrence. Our results are in line with what is known about Imp being a key factor in early brain development that influences adult brain circuitry (Munroe and Doe, 2023) and behavior (Hamid et al., 2024). Beyond development, RNA-binding proteins play roles in cell migration, maturation, and synaptic integration in mature brain cells (Chan et al., 2022). Imp, therefore, could be a player in neuronal maintenance that suppresses seizures. Identifying changes in neuronal circuitry during development as well as excitation and inhibition imbalances in animals with only adult Imp loss will be the first important step in disentangling the functional role of Imp.

The seizures observed in both Imp and Sdc neuronal knockdown animals were relatively short but conspicuous and stereotyped. Clear tonic–clonic episodes were observed in all trials. Previous Drosophila epilepsy studies suggest that time to recover determines the severity of seizures (Fischer et al., 2023). However, seizure length is a superficial way to characterize seizure phenotype. The Imp-related spasms observed in our study are similar to the seizure characteristics of other seizure models, but they lack an initial paralysis stage, resulting in a shorter recovery time. Though they have a relatively short recovery time compared with age-matched classic mutants such parabss (average, 491 s; Reynolds, 2018), eas (average, 140 s; Zhang et al., 2002), and sda (average, 37 s; Zhang et al., 2002), they have distinctive initial spasms, short paralysis bouts, and recovery seizure stages before their recovery. Several factors may contribute to the relatively less severe phenotypes that we observe. Importantly, we are only knocking Imp down in a single cell type, whereas all described seizure models are mutants. The mentioned seizure model genes are expressed in multiple cell types in addition to neurons that may contribute to seizure severity including glia, sensory neurons, motor neurons, and muscles (Li et al., 2022). Imp is also expressed in all of these cell types, which could explain the lack of paralysis and normal climbing observed in our model compared with established bang-sensitive mutants that have general motor performance defects (Reynolds, 2018). An additional consideration is that these knockdowns have only a single copy of both the GAL4 driver and the RNAi. In established mutant models, stronger phenotypes are observed in homozygous animals (Song and Tanouye, 2006). Because Imp knockdown is partial, downstream regulation of Sdc is likely diluted. We would not expect our phenotype to be as severe as observed in null models. Future studies will investigate how seizure severity changes with loss of Imp in different cell types and with ubiquitous loss of Imp. Importantly, we show that Imp knockdown in neurons alone is sufficient to generate seizures without any other behavioral defects. We can therefore leverage this seizure-specific phenotype to probe mechanisms unambiguous to seizure activity.

We provided evidence for a functionally relevant interaction between Imp and Sdc in seizure regulation, but a limitation of this study is that we have yet to identify the molecular mechanism by which Imp mediates Sdc expression. RNA-binding proteins modulate gene expression by stabilizing downstream mRNAs, modifying transcription and translation, and transporting mRNAs to different parts of the cell (Prashad and Gopal, 2021; Parra and Johnston, 2022). Multiple studies have identified that Imp controls neurodevelopmental processes by regulating downstream target mRNA expression (Medioni et al., 2014; Liu et al., 2015; Yang et al., 2017; Samuels et al., 2020; Guan et al., 2024), but the mechanisms regarding Sdc mRNA have not been explored. Because Sdc cDNA overexpression rescues seizure phenotypes in Imp knockdown, it is possible that Imp positively regulates Sdc mRNA or protein levels. Molecular assessment of how the loss of Imp changes Sdc mRNA and protein levels, as well as any changes in Sdc mRNA localization, will elucidate the mechanism by which Imp regulates Sdc and how this interaction relates to seizure regulation.

Like many RNA-binding proteins, Imp has numerous downstream targets. In addition to Sdc, some Imp targets such as Para (Royden et al., 1987; Pavlidis et al., 1994; Glasscock and Tanouye, 2005; Tao et al., 2011; Tapia et al., 2021) and Shaker (Papazian et al., 1987; Kuebler et al., 2001; Song and Tanouye, 2006) have previously been characterized for their role in seizure biology. Samuels et al. (2020) identified an additional 37 Imp targets in larval brains, so other pathways could be involved in seizure control. Additionally, other cell types could affect seizure regulation. Glia, for example, provide critical support for extracellular matrix (ECM) remodeling and perineuronal net integrity (Meyer et al., 2014; Kim et al., 2016; Nguyen et al., 2020; Tewari et al., 2022) both of which influence seizure occurrence (Dityatev and Fellin, 2008). Given that heparan sulfate proteoglycans such as Sdc are ECM proteins (Spring et al., 1994; Sarrazin et al., 2011), it will be important to investigate the role of both Imp and Sdc in glia during development and in adult brain function.

In conclusion, we show a role for the RNA-binding protein Imp in postmitotic neuronal regulation of brain function, where the loss of neuronal Imp expression causes seizure behaviors. Additionally, we provide support for a functionally relevant interaction between Imp and Sdc in seizure behavior. Our work contributes to a growing body of literature highlighting the role of RNA-binding proteins as critical regulators of brain function and opens many new exciting questions about how Imp and other RNA-binding proteins could regulate brain development and function through their role in postmitotic neurons.

Footnotes

  • The authors declare no competing financial interest.

  • We thank the members of the Link lab for critical reading of the manuscript. We thank Claude Desplan for providing the anti-Imp antibody used in this study. The monoclonal antibody Elav-9F8A9, developed by Gerald M. Rubin at Janelia Farm Research, Howard Hughes Medical Institute, was obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of the NIH and maintained at the Department of Biology, University of Iowa, Iowa City, IA 52242. We acknowledge the information provided by FlyBase (National Human Genome Research Institute Awards U41HG000739 and U24HG010859) using release FB2023_04. Stocks obtained from the Bloomington Drosophila Stock Center (NIH P40OD018537) were used in this study. P.R.R. was supported by the Eunice Kennedy Shriver National Institute of Child Health and Human Development of the National Institutes of Health under Award Number T32HD007491 and the National Institutes of Health under Ruth L. Kirschstein National Research Service Award T32HG008962 from the National Human Genome Research Institute at the University of Utah. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. N.L. was funded in part by the National Institute of Allergy and Infectious Diseases Grants R56AI170857 and R01AI170857 and the University of Utah.

This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license, which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed.

References

  1. ↵
    1. Adolph SK,
    2. DeLotto R,
    3. Nielsen FC,
    4. Christiansen J
    (2009) Embryonic expression of Drosophila IMP in the developing CNS and PNS. Gene Expr Patterns 9:138–143. https://doi.org/10.1016/j.gep.2008.12.001
    OpenUrlCrossRefPubMed
  2. ↵
    1. Bartholomew NR,
    2. Burdett JM,
    3. VandenBrooks JM,
    4. Quinlan MC,
    5. Call GB
    (2015) Impaired climbing and flight behaviour in Drosophila melanogaster following carbon dioxide anaesthesia. Sci Rep 5:15298. https://doi.org/10.1038/srep15298 pmid:26477397
    OpenUrlCrossRefPubMed
  3. ↵
    1. Cao W,
    2. Song L,
    3. Cheng J,
    4. Yi N,
    5. Cai L,
    6. Huang F,
    7. Ho M
    (2017) An automated rapid iterative negative geotaxis assay for analyzing adult climbing behavior in a Drosophila model of neurodegeneration. J Vis Exp 127:56507. https://doi.org/10.3791/56507 pmid:28931001
    OpenUrlCrossRefPubMed
  4. ↵
    1. Chan JN-M,
    2. Sánchez-Vidaña DI,
    3. Anoopkumar-Dukie S,
    4. Li Y,
    5. Benson Wui-Man L
    (2022) RNA-binding protein signaling in adult neurogenesis. Front Cell Dev Biol 10:982549. https://doi.org/10.3389/fcell.2022.982549 pmid:36187492
    OpenUrlCrossRefPubMed
  5. ↵
    1. Chauhan P,
    2. Philip SE,
    3. Chauhan G,
    4. Mehra S
    (2022) The anatomical basis of seizures. In: Epilepsy (Czuczwar SJ, ed), pp 15–25. Brisbane, Australia: Exon Publications.
  6. ↵
    1. Conway AE, et al.
    (2016) Enhanced CLIP uncovers IMP protein-RNA targets in human pluripotent stem cells important for cell adhesion and survival. Cell Rep 15:666–679. https://doi.org/10.1016/j.celrep.2016.03.052 pmid:27068461
    OpenUrlCrossRefPubMed
  7. ↵
    1. Degrauwe N,
    2. Suvà M-L,
    3. Janiszewska M,
    4. Riggi N,
    5. Stamenkovic I
    (2016) IMPs: an RNA-binding protein family that provides a link between stem cell maintenance in normal development and cancer. Genes Dev 30:2459–2474. https://doi.org/10.1101/gad.287540.116 pmid:27940961
    OpenUrlAbstract/FREE Full Text
  8. ↵
    1. Dityatev A,
    2. Fellin T
    (2008) Extracellular matrix in plasticity and epileptogenesis. Neuron Glia Biol 4:235–247. https://doi.org/10.1017/S1740925X09000118
    OpenUrlCrossRefPubMed
  9. ↵
    1. Duerinckx S, et al.
    (2021) Phenotypes and genotypes in non-consanguineous and consanguineous primary microcephaly: high incidence of epilepsy. Mol Genet Genomic Med 9:e1768. https://doi.org/10.1002/mgg3.1768 pmid:34402213
    OpenUrlPubMed
  10. ↵
    1. Faul F,
    2. Erdfelder E,
    3. Lang A-G,
    4. Buchner A
    (2007) G*Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav Res Methods 39:175–191. https://doi.org/10.3758/BF03193146
    OpenUrlCrossRefPubMed
  11. ↵
    1. Fischer FP,
    2. Karge RA,
    3. Weber YG,
    4. Koch H,
    5. Wolking S,
    6. Voigt A
    (2023) Drosophila melanogaster as a versatile model organism to study genetic epilepsies: an overview. Front Mol Neurosci 16:1116000. https://doi.org/10.3389/fnmol.2023.1116000 pmid:36873106
    OpenUrlCrossRefPubMed
  12. ↵
    1. Fujii Y,
    2. Kishi Y,
    3. Gotoh Y
    (2013) IMP2 regulates differentiation potentials of mouse neocortical neural precursor cells. Genes Cells 18:79–89. https://doi.org/10.1111/gtc.12024
    OpenUrlCrossRefPubMed
  13. ↵
    1. Gaynes JA,
    2. Otsuna H,
    3. Campbell DS,
    4. Manfredi JP,
    5. Levine EM,
    6. Chien C-B
    (2015) The RNA binding protein Igf2bp1 is required for zebrafish RGC axon outgrowth in vivo. PLoS One 10:e0134751. https://doi.org/10.1371/journal.pone.0134751 pmid:26325373
    OpenUrlCrossRefPubMed
  14. ↵
    1. Glasscock E,
    2. Tanouye MA
    (2005) Drosophila couch potato mutants exhibit complex neurological abnormalities including epilepsy phenotypes. Genetics 169:2137–2149. https://doi.org/10.1534/genetics.104.028357 pmid:15687283
    OpenUrlAbstract/FREE Full Text
  15. ↵
    1. Green MR,
    2. Sambrook J
    (2020) Total RNA isolation from Drosophila melanogaster. Cold Spring Harb Protoc. 9:101675. https://doi.org/10.1101/pdb.prot101675
    OpenUrl
  16. ↵
    1. Guan W,
    2. Nie Z,
    3. Laurençon A,
    4. Bouchet M,
    5. Godin C,
    6. Kabir C,
    7. Darnas A,
    8. Enriquez J
    (2024) The role of Imp and Syp RNA-binding proteins in precise neuronal elimination by apoptosis through the regulation of transcription factors. eLife 12:RP91634. https://doi.org/10.7554/eLife.91634 pmid:39364747
    OpenUrlCrossRefPubMed
  17. ↵
    1. Hamid A,
    2. Gattuso H,
    3. Caglar AN,
    4. Pillai M,
    5. Steele T,
    6. Gonzalez A,
    7. Nagel K,
    8. Syed MH
    (2023) The RNA-binding protein, Imp specifies olfactory navigation circuitry and behavior in Drosophila. bioRxiv 2023.05.26.542522.
  18. ↵
    1. Hamid A,
    2. Gattuso H,
    3. Caglar AN,
    4. Pillai M,
    5. Steele T,
    6. Gonzalez A,
    7. Nagel K,
    8. Syed MH
    (2024) The conserved RNA-binding protein Imp is required for the specification and function of olfactory navigation circuitry in Drosophila. Curr Biol 34:473–488.e6. https://doi.org/10.1016/j.cub.2023.12.020 pmid:38181792
    OpenUrlCrossRefPubMed
  19. ↵
    1. Hansen HT,
    2. Rasmussen SH,
    3. Adolph SK,
    4. Plass M,
    5. Krogh A,
    6. Sanford J,
    7. Nielsen FC,
    8. Christiansen J
    (2015) Drosophila Imp iCLIP identifies an RNA assemblage coordinating F-actin formation. Genome Biol 16:123. https://doi.org/10.1186/s13059-015-0687-0 pmid:26054396
    OpenUrlCrossRefPubMed
  20. ↵
    1. Johnson KG, et al.
    (2006) The HSPGs Syndecan and Dallylike bind the receptor phosphatase LAR and exert distinct effects on synaptic development. Neuron 49:517–531. https://doi.org/10.1016/j.neuron.2006.01.026
    OpenUrlCrossRefPubMed
  21. ↵
    1. Kim SY,
    2. Porter BE,
    3. Friedman A,
    4. Kaufer D
    (2016) A potential role for glia-derived extracellular matrix remodeling in postinjury epilepsy. J Neurosci Res 94:794–803. https://doi.org/10.1002/jnr.23758
    OpenUrlCrossRefPubMed
  22. ↵
    1. Kuebler D,
    2. Tanouye M
    (2002) Anticonvulsant valproate reduces seizure-susceptibility in mutant Drosophila. Brain Res 958:36–42. https://doi.org/10.1016/S0006-8993(02)03431-5
    OpenUrlCrossRefPubMed
  23. ↵
    1. Kuebler D,
    2. Zhang H,
    3. Ren X,
    4. Tanouye MA
    (2001) Genetic suppression of seizure susceptibility in Drosophila. J Neurophysiol 86:1211–1225. https://doi.org/10.1152/jn.2001.86.3.1211
    OpenUrlCrossRefPubMed
  24. ↵
    1. Lepelletier L,
    2. Langlois SD,
    3. Kent CB,
    4. Welshhans K,
    5. Morin S,
    6. Bassell GJ,
    7. Yam PT,
    8. Charron F
    (2017) Sonic hedgehog guides axons via zipcode binding protein 1-mediated local translation. J Neurosci 37:1685–1695. https://doi.org/10.1523/JNEUROSCI.3016-16.2016 pmid:28073938
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Li H, et al.
    (2022) Fly Cell Atlas: a single-nucleus transcriptomic atlas of the adult fruit fly. Science 375:eabk2432. https://doi.org/10.1126/science.abk2432 pmid:35239393
    OpenUrlCrossRefPubMed
  26. ↵
    1. Liu Z,
    2. Yang C-P,
    3. Sugino K,
    4. Fu C-C,
    5. Liu L-Y,
    6. Yao X,
    7. Lee LP,
    8. Lee T
    (2015) Opposing intrinsic temporal gradients guide neural stem cell production of varied neuronal fates. Science 350:317–320. https://doi.org/10.1126/science.aad1886
    OpenUrlAbstract/FREE Full Text
  27. ↵
    1. Medioni C,
    2. Ramialison M,
    3. Ephrussi A,
    4. Besse F
    (2014) Imp promotes axonal remodeling by regulating profilin mRNA during brain development. Curr Biol 24:793–800. https://doi.org/10.1016/j.cub.2014.02.038
    OpenUrlCrossRefPubMed
  28. ↵
    1. Meyer S,
    2. Schmidt I,
    3. Klämbt C
    (2014) Glia ECM interactions are required to shape the Drosophila nervous system. Mech Dev 133:105–116. https://doi.org/10.1016/j.mod.2014.05.003
    OpenUrlCrossRefPubMed
  29. ↵
    1. Munroe JA,
    2. Doe CQ
    (2023) Imp is expressed in INPs and newborn neurons where it regulates neuropil targeting in the central complex. Neural Dev 18:9. https://doi.org/10.1186/s13064-023-00177-9 pmid:38031099
    OpenUrlCrossRefPubMed
  30. ↵
    1. Munroe JA,
    2. Syed MH,
    3. Doe CQ
    (2022) Imp is required for timely exit from quiescence in Drosophila type II neuroblasts. PLoS One 17:e0272177. https://doi.org/10.1186/s13064-023-00177-9 pmid:38031099
    OpenUrlCrossRefPubMed
  31. ↵
    1. Nguyen PT, et al.
    (2020) Microglial remodeling of the extracellular matrix promotes synapse plasticity. Cell 182:388–403.e15. https://doi.org/10.1016/j.cell.2020.05.050 pmid:32615087
    OpenUrlCrossRefPubMed
  32. ↵
    1. Nguyen MU,
    2. Kwong J,
    3. Chang J,
    4. Gillet VG,
    5. Lee RM,
    6. Johnson KG
    (2016) The extracellular and cytoplasmic domains of syndecan cooperate postsynaptically to promote synapse growth at the Drosophila neuromuscular junction. PLoS One 11:e0151621. https://doi.org/10.1371/journal.pone.0151621 pmid:26987116
    OpenUrlCrossRefPubMed
  33. ↵
    1. Nielsen FC,
    2. Nielsen J,
    3. Christiansen J
    (2001) A family of IGF-II mRNA binding proteins (IMP) involved in RNA trafficking. Scand J Clin Lab Invest Suppl 234:93–99. https://doi.org/10.1080/713783680
    OpenUrlCrossRefPubMed
  34. ↵
    1. Nishino J,
    2. Kim S,
    3. Zhu Y,
    4. Zhu H,
    5. Morrison SJ
    (2013) A network of heterochronic genes including Imp1 regulates temporal changes in stem cell properties. eLife 2:e00924. https://doi.org/10.7554/eLife.00924 pmid:24192035
    OpenUrlCrossRefPubMed
  35. ↵
    1. Papazian DM,
    2. Schwarz TL,
    3. Tempel BL,
    4. Jan YN,
    5. Jan LY
    (1987) Cloning of genomic and complementary DNA from Shaker, a putative potassium channel gene from Drosophila. Science 237:749–753. https://doi.org/10.1126/science.2441470
    OpenUrlAbstract/FREE Full Text
  36. ↵
    1. Parra AS,
    2. Johnston CA
    (2022) Emerging roles of RNA-binding proteins in neurodevelopment. JDB 10:23. https://doi.org/10.3390/jdb10020023 pmid:35735914
    OpenUrlCrossRefPubMed
  37. ↵
    1. Pavlidis P,
    2. Ramaswami M,
    3. Tanouye MA
    (1994) The Drosophila easily shocked gene: a mutation in a phospholipid synthetic pathway causes seizure, neuronal failure, and paralysis. Cell 79:23–33. https://doi.org/10.1016/0092-8674(94)90397-2
    OpenUrlCrossRefPubMed
  38. ↵
    1. Perycz M,
    2. Urbanska AS,
    3. Krawczyk PS,
    4. Parobczak K,
    5. Jaworski J
    (2011) Zipcode binding protein 1 regulates the development of dendritic arbors in hippocampal neurons. J Neurosci 31:5271–5285. https://doi.org/10.1523/JNEUROSCI.2387-10.2011 pmid:21471362
    OpenUrlAbstract/FREE Full Text
  39. ↵
    1. Pintacuda G, et al.
    (2023) Protein interaction studies in human induced neurons indicate convergent biology underlying autism spectrum disorders. Cell Genom 3:100250. https://doi.org/10.1016/j.xgen.2022.100250 pmid:36950384
    OpenUrlCrossRefPubMed
  40. ↵
    1. Prashad S,
    2. Gopal PP
    (2021) RNA-binding proteins in neurological development and disease. RNA Biol 18:972–987. https://doi.org/10.1080/15476286.2020.1809186 pmid:32865115
    OpenUrlCrossRefPubMed
  41. ↵
    1. Ren Q,
    2. Yang C-P,
    3. Liu Z,
    4. Sugino K,
    5. Mok K,
    6. He Y,
    7. Ito M,
    8. Nern A,
    9. Otsuna H,
    10. Lee T
    (2017) Stem cell-intrinsic, seven-up-triggered temporal factor gradients diversify intermediate neural progenitors. Curr Biol 27:1303–1313. https://doi.org/10.1016/j.cub.2017.03.047
    OpenUrlCrossRefPubMed
  42. ↵
    1. Reynolds ER
    (2018) Shortened lifespan and other age-related defects in bang sensitive mutants of Drosophila melanogaster. G3 (Bethesda) 3:3953–3960. https://doi.org/10.1534/g3.118.200610 pmid:30355763
    OpenUrlPubMed
  43. ↵
    1. Royden CS,
    2. Pirrotta V,
    3. Jan LY
    (1987) The tko locus, site of a behavioral mutation in D. melanogaster, codes for a protein homologous to prokaryotic ribosomal protein S12. Cell 51:165–173. https://doi.org/10.1016/0092-8674(87)90144-9
    OpenUrlCrossRefPubMed
  44. ↵
    1. Samuels TJ,
    2. Järvelin AI,
    3. Ish-Horowicz D,
    4. Davis I
    (2020) Imp/IGF2BP levels modulate individual neural stem cell growth and division through myc mRNA stability. eLife 9:e51529. https://doi.org/10.7554/eLife.51529 pmid:31934860
    OpenUrlCrossRefPubMed
  45. ↵
    1. Sarrazin S,
    2. Lamanna WC,
    3. Esko JD
    (2011) Heparan sulfate proteoglycans. Cold Spring Harb Perspect Biol 3:a004952. https://doi.org/10.1101/cshperspect.a004952 pmid:21690215
    OpenUrlAbstract/FREE Full Text
  46. ↵
    1. Schieweck R,
    2. Ninkovic J,
    3. Kiebler MA
    (2021) RNA-binding proteins balance brain function in health and disease. Physiol Rev 101:1309–1370. https://doi.org/10.1152/physrev.00047.2019
    OpenUrlCrossRefPubMed
  47. ↵
    1. Shneker BF,
    2. Fountain NB
    (2003) Epilepsy. Dis Mon 49:426–478. https://doi.org/10.1016/S0011-5029(03)00065-8
    OpenUrlCrossRefPubMed
  48. ↵
    1. Song J,
    2. Tanouye MA
    (2006) Seizure suppression by shakB2, a gap junction mutation in Drosophila. J Neurophysiol 95:627–635. https://doi.org/10.1152/jn.01059.2004
    OpenUrlCrossRefPubMed
  49. ↵
    1. Spring J,
    2. Paine-Saunders SE,
    3. Hynes RO,
    4. Bernfield M
    (1994) Drosophila syndecan: conservation of a cell-surface heparan sulfate proteoglycan. Proc Natl Acad Sci U S A 91:3334–3338. https://doi.org/10.1073/pnas.91.8.3334 pmid:8159748
    OpenUrlAbstract/FREE Full Text
  50. ↵
    1. Tao H, et al.
    (2011) Mutations in prickle orthologs cause seizures in flies, mice, and humans. Am J Hum Genet 88:138–149. https://doi.org/10.1016/j.ajhg.2010.12.012 pmid:21276947
    OpenUrlCrossRefPubMed
  51. ↵
    1. Tapia A,
    2. Giachello CN,
    3. Palomino-Schätzlein M,
    4. Baines RA,
    5. Galindo MI
    (2021) Generation and characterization of the Drosophila melanogaster paralytic gene knock-out as a model for Dravet syndrome. Life (Basel) 11:1261. https://doi.org/10.3390/life11111261 pmid:34833136
    OpenUrlPubMed
  52. ↵
    1. Tewari BP,
    2. Chaunsali L,
    3. Prim CE,
    4. Sontheimer H
    (2022) A glial perspective on the extracellular matrix and perineuronal net remodeling in the central nervous system. Front Cell Neurosci 16:1022754. https://doi.org/10.3389/fncel.2022.1022754 pmid:36339816
    OpenUrlCrossRefPubMed
  53. ↵
    1. Tiruchinapalli DM,
    2. Oleynikov Y,
    3. Kelic S,
    4. Shenoy SM,
    5. Hartley A,
    6. Stanton PK,
    7. Singer RH,
    8. Bassell GJ
    (2003) Activity-dependent trafficking and dynamic localization of zipcode binding protein 1 and beta-actin mRNA in dendrites and spines of hippocampal neurons. J Neurosci 23:3251–3261. https://doi.org/10.1523/JNEUROSCI.23-08-03251.2003 pmid:12716932
    OpenUrlAbstract/FREE Full Text
  54. ↵
    1. van Elburg RAJ,
    2. van Ooyen A
    (2010) Impact of dendritic size and dendritic topology on burst firing in pyramidal cells. PLoS Comput Biol 6:e1000781. https://doi.org/10.1371/journal.pcbi.1000781 pmid:20485556
    OpenUrlCrossRefPubMed
  55. ↵
    1. Vijayakumar J,
    2. Perrois C,
    3. Heim M,
    4. Bousset L,
    5. Alberti S,
    6. Besse F
    (2019) The prion-like domain of Drosophila Imp promotes axonal transport of RNP granules in vivo. Nat Commun 10:2593. https://doi.org/10.1038/s41467-019-10554-w pmid:31197139
    OpenUrlCrossRefPubMed
  56. ↵
    1. Yang C-P,
    2. Samuels TJ,
    3. Huang Y,
    4. Yang L,
    5. Ish-Horowicz D,
    6. Davis I,
    7. Lee T
    (2017) Imp and Syp RNA-binding proteins govern decommissioning of Drosophila neural stem cells. Development 144:3454–3464. https://doi.org/10.1242/dev.149500 pmid:28851709
    OpenUrlAbstract/FREE Full Text
  57. ↵
    1. Yaniv K,
    2. Yisraeli JK
    (2002) The involvement of a conserved family of RNA binding proteins in embryonic development and carcinogenesis. Gene 287:49–54. https://doi.org/10.1016/S0378-1119(01)00866-6
    OpenUrlCrossRefPubMed
  58. ↵
    1. Zhang H,
    2. Tan J,
    3. Reynolds E,
    4. Kuebler D,
    5. Faulhaber S,
    6. Tanouye M
    (2002) The Drosophila slamdance gene: a mutation in an aminopeptidase can cause seizure, paralysis and neuronal failure. Genetics 162:1283–1299. https://doi.org/10.1093/genetics/162.3.1283 pmid:12454073
    OpenUrlAbstract/FREE Full Text

Synthesis

Reviewing Editor: Catherine Schevon, Columbia University

Decisions are customarily a result of the Reviewing Editor and the peer reviewers coming together and discussing their recommendations until a consensus is reached. When revisions are invited, a fact-based synthesis statement explaining their decision and outlining what is needed to prepare a revision will be listed below. The following reviewer(s) agreed to reveal their identity: Richard Baines, Tristan Sands.

The revised manuscript is improved. A few minor changes are requested to improve clarity and accuracy.

1. The terms 'development' and 'mature' are not well explained in the section using temperature to manipulate nsyb GAL4. The methods section should make clear which stages of the life cycle were manipulated. Does 'developmental' include embryo, larva and pupa in addition to young adult, whilst mature is restricted to just adult flies?

2. The discussion states that sda adults seize for ~20 secs. This is not fully accurate. Zhang et al states that the initial paralysis takes ~20sec. However, this is not full recovery, and adults go on to show post-paralysis hyperactivity. This study reports a 50% full recovery rate takes ~ 37 sec and their figure (fig 1) shows 100% recovery of all flies takes ~ 60 secs. Note, eas and para(bss) tested at the same time in this same study exhibit 50% recovery times or 140 and 150 sec, respectively.

3. The contention that imp KD seizures are short because only one cell type is being manipulated is a little disingenuous. nSyb expresses in all neurons. Thus, whilst glia may contribute to seizures, it seems that all neurons should produce a near maximal effect, in most instances. Of course, this could be tested using a pan-cellular GAL4 such as an actin driver (or similar). For this argument to hold, the authors would need to demonstrate that established seizure mutations are expressed more widely than neurons.

4. The inability to demonstrate a direct effect on syndecan remains a weakness of the manuscript. This is fine but then the title needs to be altered to more accurately reflect what has been demonstrated. This should also be explicitly described as a study limitation in discussion.

Author Response

The revised manuscript is improved. A few minor changes are requested to improve clarity and accuracy.

We thank the reviewers for the helpful comments that improve clarity of our manuscript. We have addressed each comment individually below.

1. The terms 'development' and 'mature' are not well explained in the section using temperature to manipulate nsyb GAL4. The methods section should make clear which stages of the life cycle were manipulated. Does 'developmental' include embryo, larva and pupa in addition to young adult, whilst mature is restricted to just adult flies? We updated our methods section to include the developmental stages and made the sentence indicating time of adult collection more transparent.

2. The discussion states that sda adults seize for ~20 secs. This is not fully accurate. Zhang et al states that the initial paralysis takes ~20sec. However, this is not full recovery, and adults go on to show post-paralysis hyperactivity. This study reports a 50% full recovery rate takes ~ 37 sec and their figure (fig 1) shows 100% recovery of all flies takes ~ 60 secs. Note, eas and para(bss) tested at the same time in this same study exhibit 50% recovery times or 140 and 150 sec, respectively.

We updated the discussion section with the full recovery time, not just recovery after paralysis. We also elaborated on paralysis states in our model vs the established seizure models as well as our interpretation.

3. The contention that imp KD seizures are short because only one cell type is being manipulated is a little disingenuous. nSyb expresses in all neurons. Thus, whilst glia may contribute to seizures, it seems that all neurons should produce a near maximal effect, in most instances. Of course, this could be tested using a pan-cellular GAL4 such as an actin driver (or similar). For this argument to hold, the authors would need to demonstrate that established seizure mutations are expressed more widely than neurons.

We included expression information in our discussion.

4. The inability to demonstrate a direct effect on syndecan remains a weakness of the manuscript. This is fine but then the title needs to be altered to more accurately reflect what has been demonstrated. This should also be explicitly described as a study limitation in discussion.

We have changed the wording of the title to exclude "induces" as requested by the editor as well as added an explicit statement in the discussion siting the lack of molecular mechanism as a study limitation.

Back to top

In this issue

eneuro: 12 (5)
eNeuro
Vol. 12, Issue 5
May 2025
  • Table of Contents
  • Index by author
  • Masthead (PDF)
Email

Thank you for sharing this eNeuro article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Loss of Neuronal Imp Contributes to Seizure Behavior through Syndecan Function
(Your Name) has forwarded a page to you from eNeuro
(Your Name) thought you would be interested in this article in eNeuro.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
Loss of Neuronal Imp Contributes to Seizure Behavior through Syndecan Function
Paula R. Roy, Nichole Link
eNeuro 21 April 2025, 12 (5) ENEURO.0545-24.2025; DOI: 10.1523/ENEURO.0545-24.2025

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Share
Loss of Neuronal Imp Contributes to Seizure Behavior through Syndecan Function
Paula R. Roy, Nichole Link
eNeuro 21 April 2025, 12 (5) ENEURO.0545-24.2025; DOI: 10.1523/ENEURO.0545-24.2025
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Footnotes
    • References
    • Synthesis
    • Author Response
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • Drosophila
  • neurogenetics
  • RNA-binding proteins
  • seizure

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

Research Article: New Research

  • Neural mechanisms of self-generated action sequences
  • Assessment of cell-type-specific excitatory synaptic strength in the dorsolateral striatum of goal-directed and habitual cocaine-seeking behavior
  • Heading and then saccades predict visual discrimination decisions in freely moving ferrets
Show more Research Article: New Research

Disorders of the Nervous System

  • Erbin Confers Neuroprotection Against Cerebral Ischemia-Reperfusion Injury in Mice via MAPK Pathway Inhibition
  • Deep Learning Discriminates Seizures from Normal Brain Oscillations in the Electroencephalogram of a Rat Model of Post-traumatic Epilepsy
  • A Multi-Network Approach Identifies Proteins Related to Dendritic Spines in Alzheimer’s Disease
Show more Disorders of the Nervous System

Subjects

  • Disorders of the Nervous System
  • Home
  • Alerts
  • Follow SFN on BlueSky
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Latest Articles
  • Issue Archive
  • Blog
  • Browse by Topic

Information

  • For Authors
  • For the Media

About

  • About the Journal
  • Editorial Board
  • Privacy Notice
  • Contact
  • Feedback
(eNeuro logo)
(SfN logo)

Copyright © 2026 by the Society for Neuroscience.
eNeuro eISSN: 2373-2822

The ideas and opinions expressed in eNeuro do not necessarily reflect those of SfN or the eNeuro Editorial Board. Publication of an advertisement or other product mention in eNeuro should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in eNeuro.