Article Figures & Data
Figures
- Figure 1.
Neuronal network silencing with TTX results in increased DCV marker intensity in neurites and potentiated DCV exocytosis upon washout in mouse cortical neurons. A, Experimental schematic manipulating network activity to induce synaptic scaling and measure effect on DCV fusion events (NPY-pHluorin) and calcium influx (GCaMP7f). Mouse cortical neurons were treated with sodium channel blocker (TTX, 1 µM) for 24 h before imaging. B, NPY-pHluorin as optical reporter for DCV exocytosis, repetitive electrical stimulation (16 trains of 50 APs at 50 Hz) is represented by blue bars. C, Exemplary image of a neuron during live cell imaging protocol. Full size image shows NPY-pHluorin puncta upon NH4+ perfusion for total DCV pool quantification (scale bar, 20 µm). Panels show a neurite before stimulation (1), during stimulation displaying fusion events (2), after stimulation (3), and the total number of NPY-pHluorin labeled DCVs upon NH4+ perfusion (4). Scale bar, 4 µm. D, Cumulative plot of DCV fusion events in control (red), mean = 17,58, and TTX treated (black), mean = 129,4 neurons (after TTX washout). Shaded area represents SEM. Blue bars represent repetitive electrical stimulation (16 trains of 50 APs at 50 Hz). E, Average DCV fusion events, total pool, and release fraction per cell in control (n = 43, N = 3) and TTX (n = 49, N = 3) treated neurons. Mann–Whitney U test: Fusion events: ****p = 3.887258× 10−14. Total Pool***p = 0.000195298. Release Fraction ****p = 8.73× 10−11. Bars represent mean + SEM. F, Number of calcium induced fluorescence peaks in mass cultures of cortical neurons representing spontaneous network activity. Control (blue) and TTX (1 µM) incubated for 0, 24 or 48 h (red). n = 3. Neurons infected with GCaMP7f were imaged for 5 min in the presence of TTX (0 h), same neurons were imaged again for 5 min after 24 and 48 h. Mean intensity was measured placing a ROI around somas and background subtraction. G, Example images of ctrl neuron expressing GCaMP7f (left) with Kymograph of intracellular calcium levels (right) upon repetitive electrical stimulation (blue bars). H, Average normalized ΔF / F0 traces of intracellular calcium (GCaMP7f) of wild-type cortical neurons with (red) or without (gray) TTX, with indicated repetitive electrical stimulation (16 trains of 50 APs at 50 Hz) in blue bars. Mouse cortical neurons were treated with sodium channel blocker (TTX, 1 µM) 24 h before imaging. N = 3, n = 40–45. I, Average of Ca2+ influx, 1st train, last train, and last/1st train per cell in control (n = 43, N = 3) and TTX (n = 49, N = 3) treated neurons. Mann–Whitney U test: Area under the curve: *p = 0.0319. 1st train: *p = 0.0365. Last train: ns, p = 0.2455. Last/1st train: ns, p = 0.3566. Bars represent mean + SEM. Mann–Whitney test, *p < 0.05, **p < 0.01, ***p < 0.001, ns p > 0.05. Dots represent individual neurons, n = number of neurons, N = number of independent experiments.
- Figure 2.
Blocking action potential-mediated synaptic activity leads to an increase in DCV marker intensities in neurites of mouse cortical neurons. A, Experimental schematic. Top, Cortical neurons infected with either NPY-pHluorin or the genetic calcium indicator GCaMP7f (see also Fig. 1). Bottom, Scheme of a typical neuron stained for two different DCV markers and MAP-2 neurites indicated in blue. Fluorescence intensity of DCV markers was measured in neurites (blue). B, Representative images of control or TTX-treated DIV15 neurons infected (DIV9) with NPY-pHluorin or the genetic calcium indicator GCaMP7f. Neurons were costained for ChgB or IA-2. Scale bar, 16 µm. Red boxes indicate position of zooms. Zoom scale bar 8µm. C, Fluorescence marker intensity in neurites of mouse cortical neurons. NPY-pHluorin (n = 59, N = 3) ****p = 1.59× 10−13, ChgB (n = 60, N = 3) ****p = 1.36× 10−09, IA-2 (n = 31. N = 3) ****p = 9.10× 10−07, GCaMP7f (n = 29, N = 3) ns, p = 0.1005, control and TTX-treated neurons. Mann–Whitney U test: The data are presented as the mean ± SEM.
- Figure 3.
Blocking action potential-mediated synaptic activity leads to an increase in DCV marker intensities in GABAergic neurites of mouse cortical neurons. A, Experimental schematic, manipulating network activity to induce synaptic scaling and measure effect on DCV numbers. Mouse cortical neurons were treated with sodium channel blocker (TTX, 1 µM) for 4, 24, or 48 h before fixation at DIV21. B, C, Scheme of a typical neuron stained for three different DCV markers. Fluorescence intensity of DCV markers was measured in neurites (blue). GABAergic neurons in red were stained for NPY and IA-2. D, NPY-positive GABAergic neurons were manually selected on an array scan of the entire coverslip. Scale bar, 100 µm. E, Representative composite confocal images of cortical neurons depicting NPY for every treated condition. Scale bars, 10 μm. Red squares indicate position of zooms of soma region showing NPY accumulation in Golgi area and increase in NPY-positive puncta outside Golgi after treatment with TTX. F, Normalized quantified fluorescence markers NPY endogenous and IA-2 in neurites of mouse cortical neurons (n = 42–44, N = 3). NPY: ctrl versus 4 h p = 0.98, ctrl versus 24 h p < 0.0001, ctrl versus 48 h p < 0.0001. IA-2: ctrl versus 4 h p = 0.8073, ctrl versus 24 h p = 0.0002, ctrl versus 48 h p = 0.0007. The data are presented as the mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001; and ****p < 0.0001. Ordinary one-way ANOVA. n = number of neurons, N = number of independent experiments. G, Normalized quantified fluorescence markers in neurites of mouse cortical neurons. Different DCVs markers were labeled ChgB (n = 26, N = 3), IA-2 (n = 46, N = 3), and NPY-pHluorin (n = 26, N = 3). ChgB: ctrl versus 4 h p < 0.0001, ctrl versus 24 h p < 0.0001, ctrl versus 48 h p < 0.0001. IA-2: ctrl versus 4 h p = 0.0033, ctrl versus 24 h p = 0.0014, ctrl versus 48 h p = 0.0013. NPY-pHluorin: ctrl versus 4 h p = 0.1358, ctrl versus 24 h p = 0.5237, ctrl versus 48 h p < 0.0001. The data are presented as the mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001; and ****p < 0.0001. Ordinary one-way ANOVA. n = number of neurons, N = number of independent experiments. H, Representative composite confocal images of cortical neurons depicting NPY-pHluorin and Homer1 at DIV9 after 48 h of TTX treatment. Scale bars, 10 μm. I, Quantified fluorescence intensity of DCV markers for every treated condition. NPY-pHluorin p = 5.87× 10−06, Homer p = 0.0179. The data are presented as the mean ± SEM. Mann–Whitney test, *p < 0.05, **p < 0.01, ***p < 0.001, ns p > 0.05.
- Figure 4.
TTX-induced network silencing results in the decreased transcription of neuropeptide genes in mouse cortical neurons. A, mRNA levels of different neuropeptide and DCV cargo transcripts of Ctrl and TTX-treated cortical neurons as assessed by quantitative RT-PCR and normalized to GAPDH. Data are shown as fold changes (FC) relative to control levels in the corresponding culture preparation. n = 8, N = 4 biological independent experiments. Dots represent individual cultures, bar graphs are geometric means, and error bars are geometric SD. Log2FC (ΔΔCt) were analyzed by one-sample t test. **p < 0.01; ***p < 0.001; ****p < 0.0001. ns, not significant. n, number of samples (wells); N, number of independent experiments. NPY p < 0.0001, ChgB p = 0.55, Ptprn p = 0.0326, CCK p = 0.0117, Bdnf p = 0.001, Sst p = 0.0091, Vgf p = 0.0001, Pam p < 0.0001, Scg2 p < 0.0001. B, Quantification of ChgB, IA-2, and Homer1 levels as detected by Western blot (WB) in lysates of Ctrl and TTX-treated wild-type neurons for 24 h TTX treatment. Error bars represent SD. Data were analyzed using a two-tailed paired t test n = 3 biological independent experiments. C, Chromogranin B (ChgB) and actin levels as detected by western blot (WB) in lysates of Ctrl and TTX-treated cortical neurons for four different timepoints of TTX treatment (1–4 d). Quantification of ChgB bands intensity from WB exemplified in C for four different timepoints of TTX treatment. Error bars represent SD. Data were analyzed using a two-tailed paired t test (4 biological independent experiments).
- Figure 5.
TeNT induced block of secretory vesicle exocytosis increases DCV marker intensity in mouse cortical neurons. A, Representative composite confocal image of TeNT infected or control cortical neurons. Neurons were stained for Synaptobrevin2, MAP-2, and NPY-pHluorin; Scale bars, 10 μm. B, Quantified fluorescence of Synaptobrevin2 in neurites, synapses, and soma of control and TeNT-expressing neurons. MAP-2 intensity is similar between Ctrl and TeNT infected neurons. The data are presented as the mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001; and ****p < 0.0001. Synaptobrevin2 (n = 51. N = 3) control and TTX-treated neurons, p < 0.0001. MAP-2 p = 0.1788. C, Representative composite confocal image of TeNT infected or control cortical neurons. Neurons were stained for NPY endogenous and IA-2. Scale bars, 10 μm. D, Quantified fluorescence intensity of DCV markers in neurites of TeNT infected or control cortical neurons. The data are presented as the mean ± SEM. NPY-pHluorin (n = 96, N = 4) p = 1.73× 10−15, ChgB (n = 35, N = 3) p = 2.42× 10−05, NPY endogenous (n = 100, N = 4), Ia-2 (n = 100, N = 3) p = 3.15× 10−05, control and TTX-treated neurons. Mann–Whitney test, *p < 0.05, **p < 0.01, ***p < 0.001, ns p > 0.05. Dots represent individual neurons; n, number of neurons; N, number of independent experiments.
Tables
Reagent type (species) or resource Designation Source or reference Identifiers Additional information Genetic reagent (Mus musculus) C57BL/6 J Charles River Strain code 631 Genetic reagent (Rattus norvegicus) Wistar (Crl:WI) Charles River Strain code: 003 Used for preparation of glia feeder layer Antibody Anti-NPY (rabbit polyclonal) Cell Signaling 11,976 1:400 Antibody Anti-VAMP2 (mouse monoclonal) Synaptic Systems 104211 1:2,000 Antibody Anti-actin (mouse monoclonal) Merck MAB1501 1:1,000 Antibody Anti-MAP-2 (chicken polyclonal) Abcam ab5392 1:5,000 Antibody Anti-IA-2 (PTPRN) (mouse monoclonal) Merck MABS469 1:100 Antibody Anti-CHGB (rabbit polyclonal) Synaptic Systems 259103 1:500 Antibody Anti-BDNF (mouse monoclonal) DSHB hybridoma product BDNF #9 (supernatant)1 1:4 Antibody Anti-GAPDH (rabbit polyclonal) Elabscience E-AB-40337 1:2,000 Recombinant DNA reagent pLenti-Syn(pr)- TeNT-IRES- mCherry Hoogstraaten et al. (2020) - Recombinant DNA reagent pLenti-Syn(pr)-pre-NPY-pHluorin - Sequence-based reagent qPCR primers are Listed in Table 2 Peptide, recombinant protein 2.5% trypsin Invitrogen 15090046 Peptide, recombinant protein Papain Worthington Biochemical Corporation LS003127 Peptide, recombinant protein Poly-ʟ-ornithine Sigma P4957 Peptide, recombinant protein Laminin Sigma L2020 Peptide, recombinant protein Rat tail collagen BD Biosciences 354,236 Peptide, recombinant protein Poly-d-lysine Sigma P6407 Commercial assay or kit SensiFast cDNA Synthesis Kit Meridian Bioscience BIO-65054 Commercial assay or kit SensiFast SYBR Lo-ROX Kit Meridian Bioscience BIO-94020 Software, algorithm MATLAB MathWorks - Software, algorithm Prism GraphPad - Software, algorithm Fiji/ImageJ NIH - Gene Forward primer sequence Reverse primer sequence Bdnf (all transcripts) GGCTGACACTTTTGAGCACGTC CTCCAAAGGCACTTGACTGCTG Vgf CTTTGACACCCTTATCCAAGGCG GCTAATCCTTGCTGAAGCAGGC Pam AGTCGGATCGTGCAGTTCTCAC ACTGGTTCAGGTGAGGCACAAG Ptprn TGGCAGGCTATGGAGTAGAGCT CTTGACATCGGCTCCTCCAACA ChgB GACGAATTTCCCGATTTCTAC CCAGTTCCTTTTTCTCTTCCG Scg2 CAGGAAGAGGTGAGAGACAGCA TGGAGGCATCCTCTGAGAGTTG Npy TACTCCGCTCTGCGACACTACA GGCGTTTTCTGTGCTTTCCTTCA Cck GAGGTGGAATGAGGAAACAA CAGATTTCACATTGGGGACT Sst TCTGGAAGACATTCACATCC TTCTAATGCAGGGTCAAGTT Gapdh CATCACTGCCACCCAGAAGACTG ATGCCAGTGAGCTTCCCGTTCAG
In this issue
