Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT

User menu

Search

  • Advanced search
eNeuro
eNeuro

Advanced Search

 

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT
PreviousNext
Research ArticleResearch Article: New Research, Sensory and Motor Systems

Hawkmoth Pheromone Transduction Involves G-Protein–Dependent Phospholipase Cβ Signaling

Anna C. Schneider, Katrin Schröder, Yajun Chang, Andreas Nolte, Petra Gawalek and Monika Stengl
eNeuro 29 January 2025, 12 (3) ENEURO.0376-24.2024; https://doi.org/10.1523/ENEURO.0376-24.2024
Anna C. Schneider
University of Kassel, Kassel 34132, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Anna C. Schneider
Katrin Schröder
University of Kassel, Kassel 34132, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yajun Chang
University of Kassel, Kassel 34132, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Yajun Chang
Andreas Nolte
University of Kassel, Kassel 34132, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Petra Gawalek
University of Kassel, Kassel 34132, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Monika Stengl
University of Kassel, Kassel 34132, Germany
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Monika Stengl
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Extended Data
  • Figure 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1.

    Quantification of the three phases of the pheromone response of hawkmoth long trichoid sensilla. The BAL-elicited spiking response consists of three consecutive spiking patterns (3 components) with distinct kinetics but variable duration (1) a phasic, high-frequency spiking response that lasts <100 ms (A), (2) a tonic spiking response with lower and more variable spiking frequency that lasts >100 ms (A), and (3) a late long-lasting spiking response (LLPR) that lasts seconds to minutes (B) (Dolzer et al., 2003; Nolte et al., 2016). A, High-pass filtered (AC, top trace) and unfiltered (DC, bottom trace) recording of the sensillum potential with APs of the phasic–tonic ORN response to BAL. BAL stimulus: 50 ms, 10 µl of 0.1 mg/ml on 1 cm2 filter paper; arrow: start of the BAL response. For the phasic response, we calculated the average instantaneous AP frequency of the first six APs (F6AP, red ticks, top trace) of the BAL response. A combination of both phasic and part of the tonic response was evaluated as the number of APs in a 100 ms window starting at the onset of the BAL response [#APs (early), red box, top trace]. Latency (red horizontal marking, bottom trace) is the time from the beginning of the BAL response to the first AP. SPA is the amplitude from the baseline voltage before BAL stimulation to the negative peak (red vertical marking, bottom trace) (B) High-pass filtered recording of the LLPR. The LLPR was evaluated as the number of APs [#APs (LLPR)] in the 295 s before the next BAL stimulus, excluding the first 5 s after the BAL stimulus.

  • Figure 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2.

    Illustration of the linear fit analysis of pheromone responses. A, BAL stimuli were applied every 5 min in the 120-min-long tip-recordings of hawkmoth trichoid sensilla. For each animal and experimental condition [here, one control (black) and one GDP-β-S (red) animal], we generated a linear regression model for time and respective BAL response parameters (here, latency to the first AP after the onset of the BAL response) and used a t test to determine whether the slope of the fit significantly differed from zero (solid line) or not (dashed line). B, To quantify the response kinetics to BAL stimulation, we binned the data of the first second after the BAL stimulus in 10 ms bins across all BAL stimulations for each animal. Each resulting cumulative histogram (dotted line) was fitted with a sigmoidal function (solid line) for quantification that yielded three fit parameters: maximum spike number (APmax), time of the midpoint of the sigmoid (t1/2; indicated by arrows at the x-axis), and slope of the midpoint (k). Depicted are examples of two animals.

  • Figure 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3.

    Inhibition of G-protein signaling of pheromone-sensitive ORNs by GDP-β-S decreased the phasic BAL response and increased response latency during the hawkmoth's activity phase. A, Examples of high-pass filtered tip-recordings (AC) of ORN responses in control (ctrl, recording solution + DMSO, black) and with the G-protein antagonist GDP-β-S (dissolved in SLR + DMSO, red) at ZT 1–3, 100 min after the start of the recording. Arrow indicates the onset of BAL response. Response parameters (Fig. 1) during the moth's late activity phase (ZT 1–3; B) and at rest (ZT 9–11; C) in control and GDP-β-S. Data are shown as mean (line) ± standard deviation (shaded area). D, One-way ANOVA results with appropriate post hoc test for multiple comparisons (α = 0.05) for the slopes of BAL response parameters (see Materials and Methods and Fig. 2A). F6AP slopes decreased significantly, and latency slopes increased significantly in GDP-β-S compared with control at the activity phase (ZT 1–3). No other parameters showed significant differences compared with control at either ZT. Dots show data for individual experiments; red lines indicate the mean. Raw data are provided in Extended Data Figure 3-1.

  • Figure 4.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 4.

    Inhibition of G-protein signaling changed kinetics of the ORN response to BAL stimulation during the activity phase. A, Peristimulus time histograms (PTSH; 10 ms bins) of the first second of the ORN response to BAL stimulation in control (black) and in GDP-β-S (red). Data are shown as mean (line) ± standard deviation (shaded area). Arrow: onset of BAL response. B, Fit parameters [total number of spikes in 1 s after onset of the BAL response (APmax), time of the sigmoid midpoint (t1/2), and slope (k) of the midpoint] of sigmoidal fits to the cumulative spike histograms (see Eq. 1, Materials and Methods, and Fig. 2B). One-way ANOVA with appropriate post hoc test (α = 0.05) revealed a significantly steeper slope (k closer to zero) in control compared with GDP-β-S during the activity phase (ZT 1–3). Steeper slopes indicate faster rise and fall times of the spike count in the PTSHs. The total number of spikes and sigmoid midpoint were not significantly different. Dots show fit parameter values for individual experiments; red lines indicate the mean. Raw data are provided in Extended Data Figure 4-1.

  • Figure 5.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 5.

    Inhibition of PLC of pheromone-sensitive ORNs with U73122 decreased the phasic BAL responses at both ZTs while decreasing SPA and increasing response latency only at ZT 1–3. A, Example high-pass filtered (AC) tip-recordings of ORN responses in control (U73343, dark purple) and in PLC inhibitor (U73122, light purple) at ZT 1–3, 100 min. The arrow indicates the onset of the BAL response. Response parameters (Fig. 1) during the activity phase (ZT 1–3; B) and at rest (ZT 9–11; C) in control and U73122. Data are shown as mean (lines) ± standard deviation (shaded areas). D, One-way ANOVA results with appropriate post hoc test for multiple comparisons (α = 0.05) for the slopes of BAL response parameters (see Materials and Methods and Fig. 2A). Compared with controls, F6AP slopes decreased at both ZTs in U73122, but SPA and latency slopes increased only at the activity phase (ZT 1–3). Other BAL response parameters showed no significant differences between control and U73122 at either ZT. Dots show data of individual experiments; red lines indicate the mean. Raw data are provided in Extended Data Figure 5-1.

  • Figure 6.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 6.

    Responses to BAL stimulation at ZT 1–3 were affected by toxins that target Gαs or Gαo subunits. A, Examples of tip-recordings from ORNs with BAL stimulation in control (black), with cTox (blue), pTox (yellow), and pmTox (green); repeated measures of one animal shown for each toxin. AC: high-pass filtered recording to highlight AP response; DC: unfiltered SPA with APs; Arrow: onset of the BAL response. B, Quantification with one-way RM ANOVA with appropriate post hoc test for multiple comparisons (α = 0.05) of the same parameters as in Figure 3 and Figure 5. During the activity phase (ZT 1–3), the frequency of the phasic BAL responses (F6AP) and the number of APs during the first 100 ms of the response [#APs (early)] decreased in cTox (blue; sustained activation of Gαs) and pTox (yellow; inhibition of Gαo), while response latency increased significantly. The effect of pmTox (green; constitutive activation of Gα12/13, Gαi, and Gαq) was not different from control. Raw data are provided in Extended Data Figure 6-1.

  • Figure 7.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 7.

    Relative expression levels of mRNA for G-proteins, PLCβ, and the circadian clock protein timeless (tim) in male hawkmoth antenna at different ZTs. qPCR revealed that mRNA levels of PLCβ4 peaked significantly at the beginning of the activity phase at ZT 17. Gαo, Gαq, Gαs, and PLCβ1 did not change throughout the day. The mRNA of the cycling circadian clock protein timeless (tim) served as the positive control. Dots indicate values for biological replicates; each biological replicate contains extracts from eight antennae and three technical repeats. Red lines depict the mean. One-way ANOVA with appropriate post hoc test for pairwise comparisons (α = 0.05). The phylogenetic tree for PLCβ is provided in Extended Data Figure 7-1. Nucleotide sequences of the genes are provided in Extended Data Figure 7-2.

Tables

  • Figures
  • Extended Data
    • View popup
    Table 1.

    Forward and reverse primer sequences for target and reference genes. Asterisks indicate candidate reference genes.

    GenePrimer sequence (5′-3′)Size (bp)Reference
    timelessF: TTAAGCCGACCGTAGTGCTG120-
    R: CGTCTTCCGTCCATGTGTCT
    GαoF: AAGCTGCTGCTCCTTGGTGCT147-
    R: GGCGACGAGCGATTGAATAGTG
    GαqF: CATTCACGGGTCGGGTTACA151-
    R: CTCCGCCTTTTCTACGTTGG
    GαsF: AGTCGACCATCGTGAAGCAG126-
    R: TTGCACCGGTGATCGTAAGT
    PLCβ1F: CGACACCATAAGCCAGTCCA115-
    R: CGGTTTGCCGTCGGTTAAAT
    PLCβ4F: GATATGGATCAGCCCCTCGC137-
    R: AGTTCTACGCACCTGCATCC
    RPS13*F: GTCTTGCCCCTGACCTACCT173(Fenske et al., 2018)
    R: TGGCAGCACACTCTTTGTCT
    G3PDH*F: CGATTAAGGAACTTGAGGACG232(Mészáros and Morton, 1996; Adamo et al., 2016)
    R: ATAAGGAAGCGGATGCAAGG
    • View popup
    Table 2.

    One-way ANOVA results for BAL response parameters in control and GDP-β-S

    NParameterNormalityVarianceTest statisticdfRes.p
    10F6APPassPassF = 7.492332<0.001
    10latencyFailH = 13.97530.003
    10SPAPassFailH = 3.49730.321
    10#APs (early)PassPassF = 0.5463320.654
    10#APs (LLPR)FailH = 0.20330.977
    • If tests for normality (Shapiro–Wilk) or equal variance (Levene) failed, results are for ANOVA on ranks. The four groups are ctrl ZT 1–3, GDP-β-S ZT 1–3, ctrl ZT 9–11, and GDP-β-S ZT 9–11. p values smaller than α = 0.05 are printed in bold. N, number of animals; df, degrees of freedom; res: residual.

    • View popup
    Table 3.

    One-way ANOVA results for the fit parameters of the BAL response kinetics (Eq. 1)

    NParameterNormalityVarianceTest statisticdfres.p
    10APmaxPassPassF = 1.4143300.258
    10t1/2FailH = 7.24330.065
    10Log(slope)PassPassF = 3.2123300.037
    • Data for slope were log-transformed to ensure normal distribution. If tests for normality (Shapiro–Wilk) or equal variance (Levene) failed, results are for ANOVA on ranks. The four groups are ctrl ZT 1–3, GDP-β-S ZT 1–3, ctrl ZT 9–11, and GDP-β-S ZT 9–11. p values smaller than α = 0.05 are printed in bold. N, number of animals; df, degrees of freedom; res, residual.

    • View popup
    Table 4.

    One-way ANOVA results for BAL response parameters in control (U73343) and U73122

    NParameterNormalityVarianceTest statisticdfres.p
    10F6APPassPassF = 5.4473310.004
    10LatencyFailH = 12.18730.007
    10SPAPassPassF = 4.4933310.010
    10#APs (early)PassFailH = 10.32730.016
    10#APs (LLPR)PassPassF = 1.5583310.219
    • If tests for normality (Shapiro–Wilk) or equal variance (Levene) failed, results are for ANOVA on ranks. Groups are ctrl ZT 1-3, U73122 ZT 1-3, ctrl ZT 9-11, and U73122 ZT 9-11. p values smaller than α = 0.05 are printed in bold. N, number of animals; df, degrees of freedom; res, residual.

    • View popup
    Table 5.

    One-way RM ANOVA results for BAL response parameters in control and bacterial toxins at ZT 1–3

    NParameterNormalityVarianceTest statisticdfres.p
    28F6APPassPassF = 26.611323<0.001
    28Log(latency)PassPassF = 26.606325<0.001
    28SPAPassPassF = 1.9963240.142
    28#APs (early)PassPassF = 22.252324<0.001
    28#APs (LLPR)PassPassF = 3.7263230.026
    • Values for latency were log-transformed to ensure equal variance. Groups are ctrl, pTox, cTox, pmTox. p values smaller than α = 0.05 are printed in bold. N, number of animals; df, degrees of freedom; res, residual.

    • View popup
    Table 6.

    One-way ANOVA results for gene expression levels at ZT 1, ZT 9, and ZT 17

    NGeneNormalityVarianceTest statisticdfres.p
    3timPassPassF = 14.889260.005
    3GαoPassPassF = 4.276260.070
    3GαqPassPassF = 0.005260.995
    3GαsPassFailF = 1.479260.301
    3PLCβ1PassPassF = 1.137260.381
    3PLCβ4PassPassF = 9.001260.016
    • p values smaller than α = 0.05 are printed in bold. N, number of animals; df, degrees of freedom; res, residual.

Extended Data

  • Figures
  • Tables
  • Figure 3-1

    All data for the analysis shown in Figure 3. The excel file contains five sheets: one with the slopes and four with the raw data for the four combinations of ZT and experimental conditions from which the slopes were fitted. “slopes” contains the two datasets at ZT 1-3 and ZT 9-11. In each dataset, the first column is the unique experiment ID, the second column denotes the experimental condition, and the following columns give the slope for the five response parameters. In the other four sheets, the first column denotes the stimulation time in minutes after the electrodes were attached. Here, data are organized by experiment ID and show the value of the respective response parameter for each stimulation time point. “NaN” indicates those trials where we could not extract the relevant parameters from the recording. Download Figure 3-1, XLS file.

  • Figure 4-1

    All data for the analysis shown in Figure 4. Each dataset is a combination of ZT and experimental condition. For each dataset, the first column denotes the experiment ID, and the following three columns the respective fit parameters. Download Figure 4-1, XLS file.

  • Figure 5-1

    All data for the analysis shown in Figure 5. The excel file contains five sheets: one with the slopes and four with the raw data for the four combinations of ZT and experimental conditions from which the slopes were fitted. “slopes” contains the two datasets at ZT 1-3 and ZT 9-11. In each dataset, the first column is the unique experiment ID, the second column denotes the experimental condition, and the following columns give the slope for the five response parameters. In the other four sheets, the first column denotes the stimulation time in minutes after the electrodes were attached. Here, data are organized by experiment ID and show the value of the respective response parameter for each stimulation time point. “NaN” indicates those trials where we could not extract the relevant parameters from the recording. Download Figure 5-1, XLS file.

  • Figure 6-1

    All data for the analysis shown in Figure 6. The excel file contains three sheets, one for each toxin condition. Data are grouped by experiment ID. The first column contains the stimulation time points. Subsequent columns contain the respective response parameter at that time point. Experiments were paired with control recordings on day 1 and toxin recordings on day 2. “NaN” indicates those trials where we could not extract the relevant parameters from the recording. Download Figure 6-1, XLS file.

  • Figure 7-1

    The phylogenetic tree was constructed using the maximum likelihood method, and node support was evaluated with 1000 bootstrap replicates. Bootstrap values > 67 are shown. Black boxes and black circles represent candidate PLCβ1 and PLCβ4 of M. sexta (Gene IDs: LOC115440592 and LOC115451385), respectively. Sequence information is detailed in Extended Data Figure 7-2. Download Figure 7-1, TIF file.

  • Figure 7-2

    Nucleotide sequences for the genes used in the phylogenetic analysis. Download Figure 7-2, XLS file.

Back to top

In this issue

eneuro: 12 (3)
eNeuro
Vol. 12, Issue 3
March 2025
  • Table of Contents
  • Index by author
  • Masthead (PDF)
Email

Thank you for sharing this eNeuro article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Hawkmoth Pheromone Transduction Involves G-Protein–Dependent Phospholipase Cβ Signaling
(Your Name) has forwarded a page to you from eNeuro
(Your Name) thought you would be interested in this article in eNeuro.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
Hawkmoth Pheromone Transduction Involves G-Protein–Dependent Phospholipase Cβ Signaling
Anna C. Schneider, Katrin Schröder, Yajun Chang, Andreas Nolte, Petra Gawalek, Monika Stengl
eNeuro 29 January 2025, 12 (3) ENEURO.0376-24.2024; DOI: 10.1523/ENEURO.0376-24.2024

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Share
Hawkmoth Pheromone Transduction Involves G-Protein–Dependent Phospholipase Cβ Signaling
Anna C. Schneider, Katrin Schröder, Yajun Chang, Andreas Nolte, Petra Gawalek, Monika Stengl
eNeuro 29 January 2025, 12 (3) ENEURO.0376-24.2024; DOI: 10.1523/ENEURO.0376-24.2024
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Footnotes
    • References
    • Synthesis
    • Author Response
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • circadian clock
  • insect
  • olfaction

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

Research Article: New Research

  • Robust representation and nonlinear spectral integration of harmonic stacks in layer 4 of mouse primary auditory cortex
  • Changes in palatability processing across the estrous cycle are modulated by hypothalamic estradiol signaling
  • Automatic, but not autonomous: Implicit adaptation is modulated by goal-directed attentional demands
Show more Research Article: New Research

Sensory and Motor Systems

  • Robust representation and nonlinear spectral integration of harmonic stacks in layer 4 of mouse primary auditory cortex
  • Changes in palatability processing across the estrous cycle are modulated by hypothalamic estradiol signaling
  • Automatic, but not autonomous: Implicit adaptation is modulated by goal-directed attentional demands
Show more Sensory and Motor Systems

Subjects

  • Sensory and Motor Systems
  • Home
  • Alerts
  • Follow SFN on BlueSky
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Latest Articles
  • Issue Archive
  • Blog
  • Browse by Topic

Information

  • For Authors
  • For the Media

About

  • About the Journal
  • Editorial Board
  • Privacy Notice
  • Contact
  • Feedback
(eNeuro logo)
(SfN logo)

Copyright © 2026 by the Society for Neuroscience.
eNeuro eISSN: 2373-2822

The ideas and opinions expressed in eNeuro do not necessarily reflect those of SfN or the eNeuro Editorial Board. Publication of an advertisement or other product mention in eNeuro should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in eNeuro.