Skip to main content

Main menu

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT

User menu

Search

  • Advanced search
eNeuro
eNeuro

Advanced Search

 

  • HOME
  • CONTENT
    • Early Release
    • Featured
    • Current Issue
    • Issue Archive
    • Blog
    • Collections
    • Podcast
  • TOPICS
    • Cognition and Behavior
    • Development
    • Disorders of the Nervous System
    • History, Teaching and Public Awareness
    • Integrative Systems
    • Neuronal Excitability
    • Novel Tools and Methods
    • Sensory and Motor Systems
  • ALERTS
  • FOR AUTHORS
  • ABOUT
    • Overview
    • Editorial Board
    • For the Media
    • Privacy Policy
    • Contact Us
    • Feedback
  • SUBMIT
PreviousNext
Research ArticleResearch Article: New Research, Integrative Systems

Dissociating Mechanisms That Underlie Seasonal and Developmental Programs for the Neuroendocrine Control of Physiology in Birds

Timothy Adam Liddle, Gaurav Majumdar, Calum Stewart, Maureen M. Bain and Tyler John Stevenson
eNeuro 28 March 2024, 11 (4) ENEURO.0154-23.2023; https://doi.org/10.1523/ENEURO.0154-23.2023
Timothy Adam Liddle
1Laboratory of Seasonal Biology, School of Biodiversity, One Health, and Veterinary Medicine, University of Glasgow, Glasgow, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Timothy Adam Liddle
Gaurav Majumdar
2Department of Zoology, University of Allahabad, Allahabad, India
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Calum Stewart
1Laboratory of Seasonal Biology, School of Biodiversity, One Health, and Veterinary Medicine, University of Glasgow, Glasgow, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Maureen M. Bain
1Laboratory of Seasonal Biology, School of Biodiversity, One Health, and Veterinary Medicine, University of Glasgow, Glasgow, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tyler John Stevenson
1Laboratory of Seasonal Biology, School of Biodiversity, One Health, and Veterinary Medicine, University of Glasgow, Glasgow, United Kingdom
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Extended Data
  • Figure 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1.

    Long photoperiods induce physiological and hypothalamic neuroendocrine change associated with reproduction in adult and juvenile Japanese quail. a, Measurements of testis length showed a significant interaction between photoperiod and age. b, Fat score ratings, as established by Wingfield and Farner, were overall higher in adults and in 16L photoperiod conditions. c, qRT-PCR analyses show a significant photoperiod by age interaction on DIO2 expression in the MBH. d, A significant photoperiod by age interaction was also found in MBH DIO3 expression. Physiological and transcriptomic data from qRT-PCR were analyzed by two-way ANOVA and Tukey's HSD with an α value of p = 0.05. The letters above each group indicate pairwise comparisons by Tukey's HSD where appropriate.

  • Figure 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2.

    Volcano plots comparing age and photoperiod revealed a high number of differentially expressed transcripts. Upregulated transcripts (logFC > 1) are colored red, and downregulated transcripts (logFC < −1) are colored blue. a, Significant differentially expressed transcripts across photoperiod treatments in adults (n = 206) included FSHß, PRL, and NTS. b, Significant differentially expressed transcripts across photoperiod treatments in juveniles (n = 184) included HAPLN1. c, Significant differentially expressed transcripts across 16L age groups (n = 685) included GH. d, Significant differentially expressed transcripts across 8L age groups (n = 678) also included GH. A p-value of <0.01 was deemed significant for all plots.

  • Figure 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3.

    a, A heatmap of the top 50 most significant transcripts in the pituitary gland. Among the most significant transcripts were FSHß and GH. b–f, Targeted qRT-PCR analyses were performed in order to investigate the transcription of genes of interest influenced by photoperiod and age. b–d, There were significant main effects of both photoperiod and age on FSHß, LHß, and PRL expression, as well as an interaction effect between photoperiod and age on LHß expression. e, There was a significant photoperiod by age interaction on GH expression. f, There was a significant main effect of photoperiod and age on OPN5 expression. For the pituitary sequencing heatmap analysis, a p-value of 0.01 was deemed significant. Targeted qRT-PCR analyses were performed using two-way ANOVA and Tukey's HSD with an α value of p = 0.05. The letters above each group indicate pairwise comparisons by Tukey's HSD where appropriate. Additional data relating to these analyses are provided in Extended Data Figures 3-1 and 3-2.

Tables

  • Figures
  • Extended Data
    • View popup
    Table 1.

    Targeted qRT-PCR primer sequences and specifications, including forward and reverse primer sequences, annealing temperature, melting temperature, and expected product sizes for DIO2, DIO3, OPN5, LHβ, FSHβ, PRL, and GH

    GenePrimerAnnealing temperature (°C)Melting temperature (°C)Length (bp)
    DIO2CGCCTACAAGCAGGTCAAAC6082242
    CACACTTGCCACCAACACTCTT
    DIO3AGGCTCTCTTCCTTCGGGAT6083180
    TAGCACTTGCTAGGCAGCAC
    OPN5ATGGCATCAGACTGCAACTCC6084499
    AAGGAACAGTAGCCCAGAACG
    LHΒTTTACCGCAGCCCTTTGGGT6087125
    AGAGCCACGGGTAGGATGACTTT
    FSHΒCTGCGGTGACCATCCTGAATCTTT6285396
    GCTTCCATTGTGACTGAAGGAGCA
    PRLAATGAAACCCCGACCCTGAG6079630
    CCCCTAGTGCAACTTGAGACC
    GHGCTGCCGAGACATACAAAGAG6081109
    GAGCTGGGATGGTTTCTGAG
    ß-actinAATCAAGATCATTGCCCCAC6084114
    TAAGACTGCTGCTGACACC
    • View popup
    Table 2.

    Summary of two-way ANOVA analyses associated with Figures 1 and 3, including F- and P-statistics associated with the main effects of photoperiod and age, and their interaction, on testis length, fat score, and the expression of DIO2, DIO3, FSHβ, LHβ, PRL, GH, and OPN5E

    PhotoperiodAgePhotoperiod:age
    Testis lengthF(1,15) = 198.46, p = 4.69 × 10−10***F(1,15) = 112.75, p = 2.26 × 10−8***F(1,15) = 81.17, p = 1.94 × 10−7***
    Fat scoreF(1,16) = 9.23, p = 7.83 × 10−3**F(1,16) = 6.15, p = 2.46 × 10−2*F(1,16) = 0.00, p = 1.00 n.s.
    DIO2F(1,16) = 0.77, p = 3.94 × 10−1 n.s.F(1,16) = 6.94, p = 1.81 × 10−2*F(1,16) = 22.12, p = 2.4 × 10−4***
    DIO3F(1,17) = 10.78, p = 4.38 × 10−3**F(1,17) = 13.40, p = 1.94 × 10−3**F(1,17) = 15.30, p = 1.12 × 10−3**
    FSHβF(1,17) = 17.69, p = 5.95 × 10−4***F(1,17) = 29.54, p = 4.45 × 10−5***F(1,17) = 0.83, p = 3.75 × 10−1 n.s.
    LHβF(1,17) = 9.47, p = 6.83 × 10−3**F(1,17) = 74.37, p = 1.29 × 10−7***F(1,17) = 4.68, p = 4.51 × 10−2*
    PRLF(1,17) = 9.27, p = 7.34 × 10−3**F(1,17) = 14.64, p = 1.35 × 10−3**F(1,17) = 1.92, p = 1.83 × 10−1 n.s.
    GHF(1,16) = 3.46, p = 8.14 × 10−2 n.s.F(1,16) = 21.48, p = 2.75 × 10−4***F(1,16) = 5.67, p = 3.00 × 10−2*
    OPN5F(1,16) = 17.01, p = 7.96 × 10−4***F(1,16) = 24.79, p = 1.36 × 10−4***F(1,16) = 0.05, p = 8.21 × 10−1 n.s.
    • Additional data relating to these analyses are provided in Extended Data Tables 2-1–2-3.

    • Nonsignificant p-values are indicated by “n.s.,” p-values <0.05 are indicated by “*,” <0.01 by “**,” and <0.001 by “***.”

Extended Data

  • Figures
  • Tables
  • Table 2-1

    Raw data including physiology measurements, MBH and pituitary qPCR fold changes in gene expression, and pituitary RNA-sequencing differential expression data generated using edgeR. Differential expression analyses include those relating to simultaneous comparison of all groups, age comparisons, and photoperiod comparisons. Download Table 2-1, XLS file.

  • Table 2-2

    Functional pathway analyses comparing 8L birds with 16L birds using the Database for Annotation, Visualization and Integrated Discovery (DAVID, Sherman et al 2022). Categories and functional analysis terms have been reported alongside associated gene count, significance levels, and a total list of significantly differentially expressed genes within each category. Download Table 2-2, XLS file.

  • Table 2-3

    Functional pathway analyses comparing juvenile birds with adult birds using the Database for Annotation, Visualization and Integrated Discovery (DAVID, Sherman et al 2022). Categories and functional analysis terms have been reported alongside associated gene count, significance levels, and a total list of significantly differentially expressed genes within each category. Download Table 2-3, XLS file.

  • Figure 3-1

    Plots comparing transcript count data from Oxford Nanopore RNA-sequencing. A-C. PRL, FSHß, and GH were significantly differentially expressed across all groups. D. OPN5 was not found to be differentially expressed, contrasting qPCR data. E. NTS was significantly differentially expressed, whereas F-G. MEF2A and MEF2D were not significantly differentially expressed across treatment groups. For all analyses, a P-value of P<0.01 was deemed significant. Download Figure 3-1, TIF file.

  • Figure 3-2

    Schematic diagram representing photoperiod and developmental changes in pituitary cell type transcript expression. Expression of FSHß, LHß, PRL, TSHß and GH in pituitary cells is dependent on both the age of the quail and the experienced photoperiod conditions. Blank cells are included to indicate that transcriptomic changes are occurring in existing cells, rather than e.g., as a result of the production of new cells. Download Figure 3-2, TIF file.

Back to top

In this issue

eneuro: 11 (4)
eNeuro
Vol. 11, Issue 4
April 2024
  • Table of Contents
  • Index by author
  • Masthead (PDF)
Email

Thank you for sharing this eNeuro article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Dissociating Mechanisms That Underlie Seasonal and Developmental Programs for the Neuroendocrine Control of Physiology in Birds
(Your Name) has forwarded a page to you from eNeuro
(Your Name) thought you would be interested in this article in eNeuro.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Print
View Full Page PDF
Citation Tools
Dissociating Mechanisms That Underlie Seasonal and Developmental Programs for the Neuroendocrine Control of Physiology in Birds
Timothy Adam Liddle, Gaurav Majumdar, Calum Stewart, Maureen M. Bain, Tyler John Stevenson
eNeuro 28 March 2024, 11 (4) ENEURO.0154-23.2023; DOI: 10.1523/ENEURO.0154-23.2023

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Respond to this article
Share
Dissociating Mechanisms That Underlie Seasonal and Developmental Programs for the Neuroendocrine Control of Physiology in Birds
Timothy Adam Liddle, Gaurav Majumdar, Calum Stewart, Maureen M. Bain, Tyler John Stevenson
eNeuro 28 March 2024, 11 (4) ENEURO.0154-23.2023; DOI: 10.1523/ENEURO.0154-23.2023
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Significance Statement
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Conclusions and future research
    • Footnotes
    • References
    • Synthesis
  • Figures & Data
  • Info & Metrics
  • eLetters
  • PDF

Keywords

  • Coturnix japonica
  • MBH
  • Oxford Nanopore RNA sequencing
  • photoperiod
  • pituitary gland
  • seasonality

Responses to this article

Respond to this article

Jump to comment:

No eLetters have been published for this article.

Related Articles

Cited By...

More in this TOC Section

Research Article: New Research

  • Anxiety-associated behaviors following ablation of Miro1 from cortical excitatory neurons
  • Altered excitability and glutamatergic synaptic transmission in the medium spiny neurons of the nucleus accumbens in mice deficient in the heparan sulfate endosulfatase Sulf1
  • Different but complementary motor functions reveal an asymmetric recalibration of upper limb bimanual coordination
Show more Research Article: New Research

Integrative Systems

  • Frazzled/DCC Regulates Gap Junction Formation at a Drosophila Giant Synapse
  • A Single NPFR Neuropeptide F Receptor Neuron That Regulates Thirst Behaviors in Drosophila
  • Paclitaxel Chemotherapy Disrupts Circadian Gene Transcription and Function of the Suprachiasmatic Nuclei in Female Mice
Show more Integrative Systems

Subjects

  • Integrative Systems
  • Home
  • Alerts
  • Follow SFN on BlueSky
  • Visit Society for Neuroscience on Facebook
  • Follow Society for Neuroscience on Twitter
  • Follow Society for Neuroscience on LinkedIn
  • Visit Society for Neuroscience on Youtube
  • Follow our RSS feeds

Content

  • Early Release
  • Current Issue
  • Latest Articles
  • Issue Archive
  • Blog
  • Browse by Topic

Information

  • For Authors
  • For the Media

About

  • About the Journal
  • Editorial Board
  • Privacy Notice
  • Contact
  • Feedback
(eNeuro logo)
(SfN logo)

Copyright © 2025 by the Society for Neuroscience.
eNeuro eISSN: 2373-2822

The ideas and opinions expressed in eNeuro do not necessarily reflect those of SfN or the eNeuro Editorial Board. Publication of an advertisement or other product mention in eNeuro should not be construed as an endorsement of the manufacturer’s claims. SfN does not assume any responsibility for any injury and/or damage to persons or property arising from or related to any use of any material contained in eNeuro.