Article Figures & Data
Figures
- Figure 1.
Analysis of the spreading of human α-synuclein (α-syn) preformed fibrils (PFF) and monomers (Mono) after their intracerebroventricular (icv) injection. A, WB analysis for α-syn in the CSF 1 h after the icv injection of Mono and 1, 8, and 24 h after the icv injection of PFF. The loading volumes are mentioned underneath the blot. B, WB analysis for α-syn in the ChP (20 µg), OB (80 µg), and striatum (80 µg) 1 h after the icv injection of Mono and 1, 8, and 24 h after the icv injection of PFF. C–E, Quantification of α-syn protein levels in the ChP (C), OB (D), and striatum (E) 1 h after the icv injection of Mono (black) and 1, 8, and 24 h after the icv injection of PFF (gray). Protein levels in AU were normalized to β-actin levels and represented relative to the Mono 1 h condition (n = 3). See Extended Data Figure 1-1 for characterization of human a-synuclein (α-syn) PFF.
- Figure 2.
Analysis of the intraventricular localization of α-synuclein (α-syn) after the intracerebroventricular (icv) injection of human α-syn preformed fibrils (PFF) and monomers (Mono). A, Representative confocal images of α-syn (magenta) in the choroid plexus (ChP) of the third and the lateral ventricle 1 h after the icv injection of Mono and 1, 8, and 24 h after the icv injection of PFF (n = 3). Cell nuclei are counterstained with Hoechst (blue). The ependymal cells that line the ventricle are indicated by a white line. The scale bar represents 50 µm on the overview images and 20 µm on the zoomed-in images. See Extended Data Figure 2-1 for a z-stack reconstruction of α-syn in the ChP of the lateral ventricle 1 h after the icv injection of PFF. B, Representative confocal images of α-syn (magenta) in ChP wholemounts of the left and right lateral ventricle 1 h after the icv injection of Mono or PFF (n = 2). Cell nuclei are counterstained with Hoechst (blue). The scale bar represents 50 µm on the overview images and 10 µm on the zoomed-in images.
- Figure 3.
Analysis of inflammatory and complement gene expression in the choroid plexus (ChP), olfactory bulb (OB), and striatum after the intracerebroventricular (icv) injection of human α-synuclein (α-syn) preformed fibrils (PFF) and monomers (Mono). A–D, qRT-PCR analysis of Tnf (A), Il1β (B), Il6 (C), and C3 (D) in the ChP 6 h after the icv injection of Mono (black) and 1, 4, 6, and 24 h after the icv injection of PFF (gray), represented relative to the Mono 6 h condition (n = 5). E–H, qRT-PCR analysis of Tnf (E), Il1β (F), Il6 (G), and C3 (H) in the OB 6 h after the icv injection of Mono (black) and 1, 4, 6, and 24 h after the icv injection of PFF (gray), represented relative to the Mono 6 h condition (n = 5). I–L, qRT-PCR analysis of Tnf (I), Il1β (J), Il6 (K), and C3 (L) in the OB 6 h after the icv injection of Mono (black) and 1, 4, 6, and 24 h after the icv injection of PFF (gray), represented relative to the Mono 6 h condition (n = 5). See Extended Data Figures 3-1 and 3-2 for comparisons of the effects induced by human α-syn PFF, Mono, and PBS 1 h and 6 h after their icv injection.
- Figure 4.
Analysis of the blood–cerebrospinal fluid (CSF) barrier leakage after the intracerebroventricular (icv) injection of human α-synuclein (α-syn) preformed fibrils (PFF) and monomers (Mono). A, Blood–CSF barrier permeability 6 h after the icv injection of Mono (white) and 1, 4, 6, and 24 h after the icv injection of PFF (gray) determined by intravenous (iv) injection of fluorescently labeled 4 kDa dextran followed by an analysis of the fluorescence in the CSF. Data are represented relative to the Mono 6 h condition (n = 3–5). B, WB analysis for IgG in the CSF 1 h after the icv injection of Mono and 1, 8, and 24 h after the icv injection of PFF. The loading volumes are mentioned underneath the blot.
- Figure 5.
Analysis of a Parkinson's disease (PD)-like phenotype 2 months after the repeated intracerebroventricular (icv) injection (five injections over 5 d) of human α-synuclein (α-syn) preformed fibrils (PFF) and PBS. See Extended Data Figure 5-2 for an overview of the experimental setup of this experiment. A, Overview of brain sectioning after sampling. Section 1 contains the striatum, Section 2 contains the icv injection site, and Section 3 contains the substantia nigra. B, Representative images of α-syn phosphorylated at serine 129 (pS129 α-syn; brown) in the brain (Section 2) 2 months after the repeated icv injection of PBS (n = 6) or PFF (n = 8). The scale bar represents 100 µm. C, D, Representative images of TH staining for dopaminergic neuron fiber density in the striatum (C, Section 1) and the substantia nigra (D, Section 3) 2 months after the repeated icv injection of PBS (n = 6) or PFF (n = 8). E, F, Quantification of dopaminergic neuron fiber density based on TH staining in the striatum (E) and the substantia nigra (F) 2 months after the repeated icv injection of PBS (black, n = 6) or PFF (gray, n = 8). G–I, Inverted grid (G), beam traversal (H), and pole descent (I) at baseline and 2 months after the repeated icv injection of PBS (black, n = 6) or PFF (gray, n = 8). See Extended Data Figure 5-1 for the analysis of motor function after a single icv injection of human α-syn PFF and PBS.
Tables
- Table 1.
Overview of the sequences of the forward and the reverse primers used for qRT-PCR analysis
Gene Forward Reverse Hprt AGTGTTGGATACAGGCCAGAC CGTGATTCAAATCCCTGAAGT Rpl CCTGCTGCTCTCAAGGTT TGGTTGTCACTGCCTCGTACTT Ubc AGGTCAAACAGGAAGACAGACGTA TCACACCCAAGAACAAGCACA Gapdh TGAAGCAGGCATCTGAGGG CGAAGGTGGAAGAGTGGGAG Il1β CACCTCACAAGCAGAGCACAAG GCATTAGAAACAGTCCAGCCCATAC Il6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC Tnf ACCCTGGTATGAGCCCATATAC ACACCCATTCCCTTCACAGAG C3 CCAGCTCCCCATTAGCTCTG GCACTTGCCTCTTTAGGAAGTC
Figure 1-1
Characterization of human alpha synuclein (α-syn) pre-formed fibrils (PFF). Thioflavin T (ThT) assay of 0.05 mg/ml monomers (Mono) or PFF to confirm the presence of typical β-sheet structures in PFF but not in Mono. (B) Denaturing sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis and Coomassie stain for volumetric analysis of the supernatant fraction (SN) and pellet fraction (P) of PFF and Mono, post-centrifugation. (C) ThT kinetic seeding assay to investigate recruitment of Mono by PFF. Seeds (unsonicated or sonicated PFF) (1 mg/ml) were added at a ratio of 1:20 to Mono (0.05 mg/ml). (D-F) Representative transmission electron microscopy (TEM) images of Mono (D), unsonicated PFF (E) and sonicated PFF (F). Scale bar represents 100 nm (D) or 200 nm (E, F). (G-H) Quantification of unsonicated (G) and sonicated (H) PFF fibril length measured from the representative TEM images. (I) Representative confocal images of pS129 α-syn (red) in primary hippocampal neurons after 11 days of incubation with Mono or PFF (n=3). Cell nuclei are counterstained with Hoechst (blue) and neurons are counterstained with β-III-tubulin (green). Scale bar represents 20 µm. Download Figure 1-1, TIF file.
Figure 2-1
Analysis of the intraventricular localization of alpha-synuclein (α-syn) 1 h after the intracerebroventricular (icv) injection of human alpha synuclein (α-syn) pre-formed fibrils (PFF). Z-stack reconstruction of α-syn (magenta) in the choroid plexus (ChP) of the lateral ventricle 1 h after the icv injection of PFF (n=3). Cell nuclei are counterstained with Hoechst (blue). Scale bar (x-, y-, z-axis) represents 20 µm per square. Download Figure 2-1, TIF file.
Figure 3-1
Comparison of the effects induced by human alpha synuclein (α-syn) pre-formed fibrils (PFF), monomers (Mono) and PBS 1h and 6 h after their intracerebroventricular (icv) injection. (A-D) qRT-PCR analysis of Tnf (A), Il1β (B), Il6 (C) and C3 (D) in the choroid plexus (ChP) 1 h and 6 h after the icv injection of PBS (light grey), Mono (black) or PFF (grey). Data are represented relative to the 1 h timepoint for each treatment condition (n=5). (E) Blood-CSF barrier permeability 1 h and 6 h after the icv injection of PBS (light grey), Mono (black) or PFF (grey) determined by intravenous (iv) injection of fluorescently labelled 4 kDa dextran followed by analysis of the fluorescence in the CSF. Data are represented relative to the 1 h timepoint for each treatment condition (n=5). Download Figure 3-1, TIF file.
Figure 3-2
Comparison of the effects induced by human alpha synuclein (α-syn) pre-formed fibrils (PFF), monomers (Mono) and PBS 6 h after their intracerebroventricular (icv) injection. (A-D) qRT-PCR analysis of Tnf (A), Il1β (B), Il6 (C) and C3 (D) in the choroid plexus (ChP) 6 h after the icv injection of PBS (light grey), Mono (black) or PFF (grey). Data are represented relative to the PBS condition (n=5). (E-H) qRT-PCR analysis of Tnf (E), Il1β (F), Il6 (G) and C3 (H) in the olfactory bulb (OB) 6 h after the icv injection of PBS (light grey), Mono (black) or PFF (grey). Data are represented relative to the PBS condition (n=5). (I-L) qRT-PCR analysis of Tnf (I), Il1β (J), Il6 (K) and C3 (L) in the striatum 6 h after the icv injection of PBS (light grey), Mono (black) or PFF (grey). Data are represented relative to the PBS condition (n=5). (M) Blood-CSF barrier permeability 6 h after the icv injection of PBS (light grey), Mono (black) or PFF (grey) determined by intravenous (iv) injection of fluorescently labelled 4 kDa dextran followed by analysis of the fluorescence in the CSF. Data are represented relative to the PBS condition (n=5). Download Figure 3-2, TIF file.
Figure 5-1
Analysis of motor function after the intracerebroventricular (icv) injection of human alpha synuclein (α-syn) pre-formed fibrils (PFF) and PBS. (A-C) Beam traversal (A), pole descent (B) and inverted grid (C) test at several timepoints after the icv injection of human PFF (grey) or PBS (black) (n=8). Download Figure 5-1, TIF file.
Figure 5-2
Overview of experimental setup of repeated intracerebroventricular (icv) injection experiment. At baseline (day 0), mice were first assessed using the beam traversal test, followed by the pole descent test and finally the inverted grid test. Training for the beam traversal test and pole descent test was performed on the days preceding day 0 following the schedule as described in the materials and methods section. From day 1 until day 5, mice were icv injected daily with either 5 µl of 1 μg/μl human alpha synuclein (α-syn) pre-formed fibrils (PFF) or an equal volume of PBS. Approximately 2 months later, on day 77, mice were again assessed using the beam traversal test, followed by the pole descent test and finally the inverted grid test. Training for the beam traversal and pole descent test was not repeated at this timepoint. On day 80, mice were sacrificed. Download Figure 5-2, TIF file.
In this issue
