Article Figures & Data
Figures
- Figure 1.
Combination of HFD and STZ/I.P. induced hyperglycemia, hyperinsulinemia, and insulin resistance in mice. A, Schedule of the experimental design. B, The fasting blood glucose (FBG) levels of mice after 12 h of food deprivation. C, The serum concentrations of insulin in mice. D, The HOMA-IR index of mice. E, The body weight of the mice during the experiment. The data are presented as the mean ± SEM, with n = 8 mice in each group. *p < 0.05 and **p < 0.01 compared with the Con group.
- Figure 2.
Combination of HFD and STZ/I.P. induced AD-like neuropsychiatric dysfunction in mice. A, Outline of the OFT procedure. B, Total distance in the OFT. C, Average speed in the OFT. D, Line crossing in the OFT. E, Outline of the NOR procedure. F, The novel object recognition index in the NOR. G, Outline of the Y-maze procedure. H, The novel arm preference index in the Y-maze. I, Outline of the MWM procedure. J, The distance in the target quadrant and (K) the latency to the target quadrant in the MWM. L, The typical moving orbits in the MWM. The data are presented as the mean ± SEM, with n = 8 mice in each group. *p(#p) < 0.05 and **p(##p) < 0.01 compared with the Con group.
- Figure 3.
Combination of HFD and STZ/I.P. induced neuron injuries and blood–brain barrier damage in the hippocampus in mice. A, The typical immunofluorescent images of Map-2 (green) in the hippocampus of mice. Scale bar, 200 or 50 μm. B, Quantifcation of the pixels of Map-2–positive area. C, The typical immunofluorescent images of NeuN (red) in the hippocampus of mice. Scale bar, 200 μm. D, Quantifcation of the pixels of NeuN-positive area. E, F, The mRNA expression levels of ocln, zo-1, and clnds in the hippocampus and PFC of mice. The data are presented as the mean ± SEM, with n = 3 in each group. *p < 0.05 and **p < 0.01 compared with the Con group.
- Figure 4.
Combination of HFD and STZ/I.P. induced APP accumulation and tau hyperphosphorylation in mice. A, C, The typical immunofluorescent images of APP (red) and p-Tau (red) in the hippocampus of mice. Scale bar, 200 or 50 μm. B, D, Quantification of the pixels of APP and p-Tau–positive area. E, The colocalization of Aβ with neurons. F, The typical graph of p-Tau and APP proteins in the hippocampus and PFC of mice. G, H, The statistical analysis of the Western blotting results in the hippocampus and PFC. The data are presented as the mean ± SEM, with n = 3 in each group. *p < 0.05 and **p < 0.01 compared with the Con group.
- Figure 5.
Combination of HFD and STZ/I.P. promoted the activation of microglia and astrocytes in mice. A, The typical immunofluorescent images of IBA-1 (green) in the hippocampus of mice. Scale bar, 200, 50, or 20 μm. B, Quantification of the number of IBA1 positive cells. C, The ratio of activated microglia to the total number of microglia. D, The colocalization of CD68 with IBA-1. E, The typical immunofluorescent images of GFAP (green) in the hippocampus of mice. Scale bar, 200 or 50 μm. F, Quantification of the pixels of GFAP-positive area. The data are presented as the mean ± SEM, with n = 3 in each group. *p < 0.05 and **p < 0.01 compared with the Con group.
- Figure 6.
Combination of HFD and STZ/I.P. induced the dysregulation of the IRS1/AKT/ERK signaling pathway in mice. A, The typical graph of IRS1/AKT/ERK signaling pathway proteins in the hippocampus and PFC of mice. B, The statistical analysis of the Western blotting results in the hippocampus. C, The statistical analysis of the Western blotting results in the PFC. The data are presented as the mean ± SEM, with n = 3 in each group. *p < 0.05 and **p < 0.01 compared with the Con group.
- Figure 7.
Combination of HFD and STZ/I.P. induced the imbalance of TREM1/2 and increase of inflammatory factors in the hippocampus and the PFC of mice. A, D, The typical graph of TREM1 and TREM2 in the hippocampus and PFC of mice. B, E, The statistical analysis of the Western blotting results in the hippocampus and PFC. C, F, The mRNA expression levels of IL-1β, IL-6, and TNF-α in the hippocampus and PFC of mice. The data are presented as the mean ± SEM, with n = 3 in each group. *p < 0.05 and **p < 0.01 compared with the Con group.
- Figure 8.
AD-like neuropsychiatric dysfunction in a mice model induced by the combination of high-fat diet and intraperitoneal injection of streptozotocin. Apart from the Aβ accumulation and tau hyperphosphorylation, the neuron damage and activation of microglia and astrocytes in the hippocampus, as well as the imbalanced protein expression of the IRS1/AKT/ERK signaling pathway and TREM1/2, may also be involved in AD-like pathological process.
Tables
Gene Base sequence (5′−3′) β-Actin F: 5′-AGTGTGACGTTGACATCCGT-3′ R: 5′-TGCTAGGAGCCAGAGCAGTA-3′ TNF-α F: 5′-CACCACCATCAAGGACTCAA-3′ R: 5′-AGGCAACCTGACCACTCTCC-3′ IL-1β F: 5′-CTTTGAAGTTGACGGACCC-3′ R: 5′-TGAGTGATACTGCCTGCCTG-3′ IL-6 F: 5′-GAGGATACCACTCCCAACAGACC-3′ R: 5′-AAGTGCATCATCGTTGTTCATACA-3′ Ocln F: CTGGATCTATGTACGGCTCACA R: TCCACGTAGAGACCAGTACCT ZO-1 F: ACCACCAACCCGAGAAGAC R: CAGGAGTCATGGACGCACA Clnd5 F: ACTCTTTGTTACCTTGACCGG R: CAGCTCGTACTTCTGTGACAC
In this issue
