Article Figures & Data
Figures
- Figure 1.
TSG improved cerebral I/R damage and promoted mitophagy in MCAO rats. A, Schematic diagram of the experimental design. B,C, Rats were used to construct MCAO model, followed by subcutaneous injection of TSG (10, 20, or 40 mg/kg). B, TTC staining for determining infarction volume. C, Neurological scores. D–H, Rats were subjected to MCAO, followed by treatment with TSG (40 mg/kg). D, Hematoxylin and eosin staining for observing the morphological changes of cortical cells. E, Brain edema determined with the ratio of dry/wet weight. F, Immunofluorescence for detecting the YBX1 expression. G, Immunohistochemistry for detection of LC3 expression. H, Western bolt for detecting mitophagy-associated proteins (LC3II/I, p62, PINK1, Parkin) and Tomm20 (a mitochondrial marker). n = 5 per group. *p < 0.05; **p < 0.01; ***p < 0.001. Data are displayed as mean ± SD.
- Figure 2.
TSG promoted mitophagy and inhibited apoptosis by upregulating YBX1 and activating PINK1/Parkin signaling in OGD/R-induced neurons. A, Cell viability was determined with CCK-8 in PC12 cells treated with TSG (0, 2, 4, or 8 μM). B, C, PC12 cells were subjected to OGD/R, followed by the treatment of TSG (2, 4, or 8 μM). B, CCK-8 for measuring cell viability. C, Apoptosis detected using flow cytometry. D–F, PC12 cells were exposed to OGD/R, prior to TSG (8 μM) incubation. D, JC-1 staining for detecting MMP. E, Immunofluorescence for measuring the colocalization of LC3 and Tomm20. F, Western blot for detecting autophagy-associated proteins (LC3II/I, p62, PINK1, Parkin), Tomm20 (a mitochondrial marker), and YBX1. n = 3. *p < 0.05; **p < 0.01; ***p < 0.001. Data are displayed as mean ± SD.
- Figure 3.
TSG increased YBX1 protein expression in OGD/R-subjected neurons via upregulating USP10. A–D, PC12 cells were exposed to OGD/R, prior to TSG (8 μM) incubation. A, Western blot for determining the YBX1 protein level after the treatment of CHX. B, Western blot for testing the YBX1 protein level after the treatment of MG132. C, Detection of the YBX1 ubiquitination level. D, Western blot for detecting the USP10 protein level. E, F, Coimmunoprecipitation (E) and GST pull-down (F) for determining the interaction of USP10 and YBX1. G, H, sh-USP10 was transfected into PC12 cells. RT-qPCR and Western blot for detecting USP10 expressions. I, J, PC12 cells were transfected by sh-USP10, before being exposed to OGD/R or treated with TSG. I, RT-qPCR for determining USP10 mRNA expression. J, Western blot for testing USP10 and YBX1 protein levels. n = 3. *p < 0.05; **p < 0.01; ***p < 0.001. Data are displayed as mean ± SD.
- Figure 4.
USP10 overexpression inhibited ubiquitination-dependent degradation of YBX1 in OGD/R-subjected neurons. A–E, sh-USP10 was transfected into PC12 cells. A, RT-qPCR for determining YBX1 mRNA expression. B, Western blot for detecting the YBX1 protein level. C, Western blot for testing the YBX1 protein level after treatment with CHX. D, Western blot for determining the YBX1 protein level after MG132 treatment. E, The ubiquitination level of YBX1. F, G, pcDNA 3.1-USP10 was transfected into PC12 cells. RT-qPCR and Western blot were applied for measuring USP10 levels. H–J, pcDNA-3.1-USP10 was transfected into PC12 cells, followed by OGD/R exposure. H, RT-qPCR for detecting the USP10 mRNA level. I, Western blot for determining USP10 and YBX1 protein levels. J, The ubiquitination level of YBX1. n = 3. *p < 0.05; **p < 0.01; ***p < 0.001. Data are displayed as mean ± SD.
- Figure 5.
Knockdown of YBX1 reversed the effects of USP10 overexpression on PINK1/Parkin signaling and mitophagy in OGD/R-exposed neurons. A–B, sh-YBX1 was transfected into PC12 cells. RT-qPCR and Western bolt for detecting YBX1 expression. C–H, PC12 cells were transfected with sh-NC, sh-YBX1, pcDNA- 3.1, or pcDNA-3.1-USP10, followed by exposure to OGD/R. C, Western blot for detection of the YBX1 protein level. D, CCK-8 assay for cell viability measurement. E, Flow cytometry for determining apoptosis. F, JC-1 staining for measuring MMP. G, Immunofluorescence for detecting the colocalization of LC3 and Tomm20. H, Western blot for determining autophagy-associated proteins (LC3II/I, p62, PINK1, Parkin) and Tomm20 (a mitochondria marker). n = 3. *p < 0.05; **p < 0.01; ***p < 0.001. Data are displayed as mean ± SD.
- Figure 6.
TSG heightened mitophagy and inhibited neuronal apoptosis through upregulating USP10 in OGD/R-induced neurons. sh-NC or sh-USP10 was transfected into PC12 cells, before being exposed to OGD/R and treated with TSG. A, CCK-8 assay for cell viability detection. B, Apoptosis measured with flow cytometry. C, JC-1 staining for determining MMP. D, Immunofluorescence for detecting the colocalization of LC3 and Tomm20. E, Western blot for testing autophagy-associated proteins (LC3II/I, p62, PINK1, Parkin) and Tomm20 (a mitochondria marker). F, Immunofluorescence for detecting the colocalization of LAMP2 and LC3. n = 3. Data are shown as mean ± SD. *p < 0.05; **p < 0.01; ***p < 0.001.
Tables
Gene Forward primer (5′-3′) Reversed primer (5′-3′) USP10 AGAGGAACTTCTGGACGGACAAG CTCTGACCAAGACCACCAGC YBX1 AAGTGATGGAGGGTGCTGAC TGCCATCCTCTCTAGGCTGT GAPDH TGATGGGTGTGAACCACGAG TCATGAGCCCTTCCACGATG
In this issue
