Article Figures & Data
- Figure 1.
Treatment with TIMP2 and the TIMP2-hIgG4 fusion protein improved nesting and memory in the hippocampal-dependent memory task Y-maze. A, Human TIMP2 in mouse plasma after a single administration of protein (250 μg/kg). n = 2–3 mice per time point. B, Timeline for chronic administration experiments. Mice were homogenized based on pretreatment nesting and Y-maze performance then dosed for four weeks. TIMP2 protein and vehicle (DPBS) were administered daily while TIMP2-hIgG4 was administered every third day with vehicle on the off days. Posttreatment nesting and Y-maze assessment occurred during week 3. Sac, sacrifice. C, Percent nest scores of 5 (dome-like, complete nests) or <5 (flat nests) following three weeks of treatment. n = 10–13 mice per group. χ2 tests: Vehicle versus TIMP2 χ2(1, N = 26) = 20.29, ****p < 0.0001; Vehicle versus TIMP2-hIgG4 χ2(1, N = 23) = 6.697, **p = 0.0097. D, Average percent entries into the novel (N) and familiar (F) arms of Y-maze during the testing phase for each treatment group following three weeks of treatment. n = 8–13 mice per group. One-sample Wilcoxon signed-rank tests to compare the percent of novel entries for each group against 50% chance: Vehicle W = 23.00 p = 0.3301; TIMP2 W = 52.00, *p = 0.0425; TIMP2-hIgG4 W = 24.00, *p = 0.0469. Schematic depicting Y-maze set up. E, Total distance traveled in 5 min during the testing phase of Y-maze. n = 8–13 mice per group. Kruskal–Wallis test H(2) = 0.8808, p = 0.6438. F, Average velocity over 5 min during the testing phase of Y-maze. n = 8–13 mice per group. Kruskal–Wallis test H(2) = 0.4906, p = 0.7825. G, Endogenous mouse TIMP2 protein in plasma after four weeks of chronic administration of human TIMP2 protein. n = 10–13 per group. One-way ANOVA F(2,33) = 2.997, p = 0.0637. H, Endogenous mouse MMP2 protein in plasma after four weeks of chronic administration of human TIMP2 protein. n = 10–13 per group. Kruskal–Wallis test H(2) = 2.018, p = 0.3646. Data for A are shown as mean ± SEM, while box plots include horizontal lines representing the 25th, 50th (median), and 75th percentiles.
- Figure 2.
TIMP2 treatment increased cfos gene expression without altering neurogenesis markers or immediate early gene products in the hippocampus. A, Average hippocampal cfos gene expression relative to Gapdh measured by Taqman qPCR for each treatment group. n = 9–13 mice per group. Kruskal–Wallis test H(2) = 9.773, p = 0.0075, followed by Dunn’s multiple comparisons test: Vehicle versus TIMP2 *p = 0.0173, Vehicle versus TIMP2-hIgG4 **p = 0.0087. B, Number of c-Fos-positive (c-Fos+) cells per dentate gyrus (DG) for each treatment group. n = 6–10 mice per group. Kruskal–Wallis test H(2) = 2.129, p = 0.3450. C, Representative images of c-Fos staining in the DG of mice for each treatment group. Scale bar: 100 μm. D, Quantification of c-Fos-positive cells across the entire brain measured following iDISCO procedure. n = 8 mice per group. Mann–Whitney U test, U(n1 = n2 = 8) = 16, p = 0.1049. E, Representative images of c-Fos in cleared brain tissue using iDISCO. Images represent the average of the difference between vehicle and TIMP2 treated mice. Red color represents increased c-Fos in TIMP2 treatment relative to Vehicle and green color represents decreased c-Fos in TIMP2 treatment relative to Vehicle. F, Average thresholded percent area of immediate early gene product early growth response 1 (EGR1) in the hippocampus for each treatment group. n = 9–13 mice per group. Nested one-way ANOVA F(2,31) = 0.3232, p = 0.7263. G, Number of doublecortin-positive (DCX+) cells per dentate gyrus (DG) as a marker of newborn neurons for each treatment group. n = 8–13 mice per group. Kruskal–Wallis test H(2) = 3.126, p = 0.2095. Box plots include horizontal lines representing the 25th, 50th (median), and 75th percentiles.
- Figure 3.
TIMP2 treatment increased excitatory synapses but not inhibitory synapses in the hippocampus, potentially because of a direct mechanism of action within the brain parenchyma. A, Number of juxtaposed presynaptic Synapsin-1/2 and postsynaptic PSD-95 puncta per μm3 in the stratum radiatum of the CA1 region of the hippocampus as a readout for excitatory synapse density for each treatment group. n = 60–78 images from 10–13 mice per group. Kruskal–Wallis test H(2) = 8.004, p = 0.0183, followed by Dunn’s multiple comparisons test: Vehicle versus TIMP2 p > 0.9999, Vehicle versus TIMP2-hIgG4 *p = 0.0390. B, Number of juxtaposed presynaptic Synapsin-1/2 and postsynaptic PSD-95 puncta per μm3 in the hilus of the dentate gyrus (DG) of the hippocampus as a readout for excitatory synapse density for each treatment group. n = 42 images from 5 mice per group. Kruskal–Wallis test H(2) = 12.15, p = 0.0023, followed by Dunn’s multiple comparisons test: Vehicle versus TIMP2 **p = 0.0017, Vehicle versus TIMP2-hIgG4 *p = 0.0231. C, Representative images from the stratum radiatum of the CA1 of a single z-plane of thresholded Synapsin-1/2 (red) and PSD-95 (white) with juxtaposed synapses circled in yellow from each treatment group. Scale bar: 5 μm. D, Number of juxtaposed presynaptic Synapsin-1/2 and postsynaptic Gephyrin puncta per μm3 in the stratum radiatum of the CA1 region of the hippocampus as a readout for inhibitory synapse density for each treatment group. n = 48 images from 8 mice per group. Kruskal–Wallis test H(2) = 2.552, p = 0.2791. E, Number of juxtaposed presynaptic Synapsin-1/2 and postsynaptic Gephyrin puncta per μm3 in the hilus of the DG of the hippocampus as a readout for inhibitory synapse density for each treatment group. n = 47–48 images from 8 mice per group. Kruskal–Wallis test H(2) = 1.343, p = 0.5110. F, Representative images from the stratum radiatum of the CA1 of a single z-plane of thresholded Synapsin-1/2 (red) and Gephyrin (white) with juxtaposed synapses circled in yellow from each treatment group. Scale bar: 5 μm. G, Average thresholded percent area of CD68-positive microglia in the hippocampus for each treatment group. n = 10–13 mice per group. Nested one-way ANOVA F(2,32) = 1.589, p = 0.2199. H, Average thresholded percent area of Iba1-positive microglia in the hippocampus for each treatment group. n = 10–13 mice per group. Nested one-way ANOVA F(2,33) = 2.242, p = 0.1222. I, Representative images of CD68 (white) and Iba1 (red) microglia from the hippocampus of mice from each treatment group. Scale bar: 100 μm. J, Human TIMP2 in mouse hemibrain after a single high dose administration of protein (1 mg/kg). n = 2–3 mice per time point. Two-way ANOVA between TIMP2 and TIMP2-hIgG4 treatment groups: Treatment main effect F(1,12) = 7.288, *p = 0.0193; Time main effect F(2,12) = 10.59, p = 0.0022; Treatment × Time interaction F(2,12) = 3.258, p = 0.0741. Followed by Sidak’s multiple comparisons test: 0.5 h *p = 0.0407, 2 h p = 0.1177, 6 h p = 0.9485. Data for J are shown as mean ± SEM, while violin and box plots include horizontal lines representing the 25th, 50th (median), and 75th percentiles.
- Figure 4.
MMP protein constructs. Schematic depicting the nine MMP protein constructs assessed for binding to TIMP2 constructs using bio-layer interferometry (BLI) and surface plasmon resonance (SPR). CD, catalytic domain.
- Figure 5.
Characterization of TIMP2-MMP binding of the TIMP2 constructs. A, Bio-layer interferometry (BLI) studies were performed on the Octet Red96e. TIMP2, TIMP2-hIgG4, and Ala-TIMP2 were biotinylated with a 1:1 molar ratio of biotin to protein. MMPs were associated at 22.5 nm to captured biotinylated protein on streptavidin tips. Shown here are the binding interactions for Hu-pro-MMP2 (left), Hu-CD-MMP3 (middle), and Hu-CD-MMP9 (right) with the TIMP2 constructs. Significant binding was observed for MMP2. All curves are reference-subtracted. B, Surface plasmon resonance (SPR) bar graph data showing binding level, in response units (RU) of Hu-pro-MMP2, Hu-CD-MMP3, and Hu-CD-MMP9 against the TIMP2 constructs. Values determined from a 5-s window at specified times. Binding level is defined as the RU of a 5-s window average observed immediately before washing the CM5 chip with running buffer, i.e., analyte is still flowing over the CM5ne chip. C, SPR bar graph data showing binding stability, in RU of Hu-pro-MMP2, Hu-CD-MMP3, and Hu-CD-MMP9 against the TIMP2 constructs. Binding stability is defined as RU of a 5-s window average observed after washing the CM5 chip with running buffer for 10 s, i.e., analyte is no longer flowing over the CM5 chip. RU, response unit.
- Figure 6.
TIMP2 MMP inhibitory activity was not necessary for improvements in hippocampal-dependent memory in Y-maze or hippocampal excitatory synapses. A, Average percent entries into the novel (N) and familiar (F) arms of Y-maze during the testing phase for each treatment group following three weeks of treatment. n = 13–16 mice per group. One-sample Wilcoxon signed-rank tests to compare the percent of novel entries for each group against 50% chance: Vehicle W = 63.00, p = 0.1073; TIMP2 W = 91.00, ***p = 0.0002; Ala-TIMP2 W = 49.00, *p = 0.0273. B, Human TIMP2 in mouse plasma after a single administration of protein (250 μg/kg). n = 1–3 mice per time point. C, Number of juxtaposed presynaptic Synapsin-1/2 and postsynaptic Homer1 puncta per μm3 in the stratum radiatum of the CA1 region of the hippocampus as a readout for excitatory synapse density for each treatment group. n = 129–139 images from 17–18 mice per group. Kruskal–Wallis test H(2) = 11.94, p = 0.0026, followed by Dunn’s multiple comparisons test: Vehicle versus TIMP2 **p = 0.0011, Vehicle versus Ala-TIMP2 p = 0.1486. D, Number of juxtaposed presynaptic Synapsin-1/2 and postsynaptic Homer1 puncta per μm3 in the hilus of the dentate gyrus (DG) of the hippocampus as a readout for excitatory synapse density for each treatment group. n = 131–142 images from 17 to 18 mice per group. Kruskal–Wallis test H(2) = 10.09, p = 0.0064, followed by Dunn’s multiple comparisons test: Vehicle versus TIMP2 p = 0.1091, Vehicle versus Ala-TIMP2 **p = 0.0033. E, Representative images from the stratum radiatum of the CA1 of a single z-plane of thresholded Synapsin-1/2 (red) and Homer1 (white) with juxtaposed synapses circled in yellow from each treatment group. Scale bar: 5 μm. Data for B are shown as mean ± SEM, while box and violin plots include horizontal lines representing the 25th, 50th (median), and 75th percentiles.
Cohort Treatment groups Age at
startDosage Dosing
lengthFigures Cohort 1 TIMP2, TIMP2-hIgG4 6.5 M 250 μg/kg Single Figure 1A (PK) Cohort 2 TIMP2, Ala-TIMP2 2 M 250 μg/kg Single Figure 6B (PK) Cohort 3 Vehicle, TIMP2, TIMP2-hIgG4 23 M 250 μg/kg 4 weeks Figures 1C–H (behavior and endogenous protein),
2A–C,F,G (immediate early genes and neurogenesis),
3A–I (synapses and microglia); Tables 2, 3 (gene
expression)Cohort 4 Vehicle, TIMP2, Ala-TIMP2 21.5 M 250 μg/kg 4 weeks Figure 6A (behavior) Cohort 5 Vehicle, TIMP2, Ala-TIMP2 21.7 M 250 μg/kg 4 weeks Figure 6C–E (synapses) Cohort 6 Vehicle, TIMP2 18 M 50 μg/kg 1 week Figure 2D,E (iDISCO c-Fos); Movie 1 Cohort 7 Vehicle, TIMP2, TIMP2-hIgG4 22 M 1 mg/kg Single Figure 3J (brain penetrance) Table provides details on each mouse cohort used and corresponding figures. M, months; PK, pharmacokinetics.
Reagent type (species) or resource Designation Source or reference Identifiers Additional information Strain, strain background (Mus musculus) C57BL/6J The Jackson Laboratory Stock #000664
RRID: IMSR_JAX:000664Cell line Human Embryonic Kidney 293-6E Thermo Fisher Catalog #A14527 For work done at Grifols and Proteos Peptide, recombinant protein Human TIMP2(1–220) Grifols Diagnostic Solutions N/A Peptide, recombinant protein Human TIMP2(1-220)_human IgG4Fc Grifols Diagnostic Solutions N/A TIMP2-hIgG4 Peptide, recombinant protein Human TIMP2(1–26)_Ala_TIMP2(27–220) Grifols Diagnostic Solutions N/A Ala-TIMP2 Peptide, recombinant protein Recombinant Mouse MMP-2 (carrier-free) BioLegend Catalog #554404 Pro-enzyme
Ms-pro-MMP2Peptide, recombinant protein Recombinant Mouse MMP-3 (carrier-free) BioLegend Catalog #552704 Pro-enzyme
Ms-pro-MMP3Peptide, recombinant protein Recombinant Mouse MMP-9 (carrier-free) BioLegend Catalog #755204 Pro-enzyme
Ms-pro-MMP9Peptide, recombinant protein Recombinant Human MMP-2 (carrier-free, pro-enzyme) R&D Systems Catalog #902-MP-010 Pro-enzyme
Hu-pro-MMP2.0Peptide, recombinant protein Recombinant Human MMP-2 (carrier-free) BioLegend Catalog #554304 Pro-enzyme
Hu-pro-MMP2.1Peptide, recombinant protein Recombinant Human MMP-3 (carrier-free) BioLegend Catalog #594704 Pro-enzyme
Hu-pro-MMP3Peptide, recombinant protein Recombinant Human MMP-9 (carrier-free) BioLegend Catalog #550504 Pro-enzyme
Hu-pro-MMP9Peptide, recombinant protein Recombinant Human MMP-2 (pro-enzyme) AnaSpec Catalog #AS-72005 Pro-enzyme
Hu-pro-MMP2.2Peptide, recombinant protein Recombinant Human MMP-3 (catalytic domain) AnaSpec Catalog #AS-72006 Catalytic domain (active)
Hu-CD-MMP3Peptide, recombinant protein Recombinant Human MMP-9 (catalytic domain) AnaSpec Catalog #AS-55576-1 Catalytic domain (active)
Hu-CD-MMP9Antibody Anti-Doublecortin (guinea pig polyclonal) Millipore Catalog #AB2253
RRID: AB_1586992IHC 1:2000 Antibody Anti-EGR1, clone 15F7 (rabbit monoclonal) Cell Signaling Technology Catalog #4153
RRID: AB_2097038IHC 1:2000 Antibody Anti-CD68, clone FA-11 (rat monoclonal) Bio-Rad Catalog #MCA1957
RRID: AB_322219IHC 1:1000 Antibody Anti-Iba1 (rabbit polyclonal) FUJIFILM Wako Pure Chemical Corporation Catalog #019-19741
RRID: AB_839504IHC 1:2500 Antibody Anti-Synapsin-1/2 (chicken polyclonal) Synaptic Systems Catalog #106006
RRID: AB_262240IHC 1:1000 Antibody Anti-PSD-95, clone D27E11 (rabbit monoclonal) Cell Signaling Technology Catalog #3450
RRID: AB_2292883IHC 1:250 Antibody Anti-Homer1 (rabbit polyclonal) Synaptic Systems Catalog #160003
RRID: AB_887730IHC 1:500 Antibody Anti-Gephyrin Synaptic Systems Catalog #147018
RRID: AB_2651176IHC 1:500 Antibody Alexa 555 or 647 secondaries Invitrogen IHC 1:300 Antibody Anti-c-Fos, clone 9F6 (rabbit monoclonal) Cell Signaling Technology Catalog #2250
RRID: AB_2247211IHC 1:1000
iDISCO 1:1000Antibody Biotinylated anti-guinea pig IgG (goat) Vector Laboratories Catalog #BA-7000
RRID: AB_2336132IHC 1:300 Other Hoechst Invitrogen Catalog #H3570 IHC 1:10,000 Other Prolong Gold Antifade Mountant Invitrogen Catalog #P36934 Other Series S Sensor Chip CM5 Cytiva Catalog #29149603 Other Streptavadin Octet Tips Sartorius Catalog #18-0009 SA Other Protein A Octet Tips Sartorius Catalog #18–0004 ProA Other 4–15% Criterion TGX Stain Free Midi Protein Gel, 26-well Bio-Rad Catalog #6578085 Other Hitrap SP Sepharose HP Column Cytiva Catalog #17115201 For work done at Grifols Other SP-Sepharose Fast Flow Resin Cytiva Catalog #17072901 For work done at Proteos Other HiTrap MabSelect SuRe Cytiva Catalog #11003495 For work done at Grifols Other Protein A Praesto AC Purolite Catalog #PR00200-310 For work done at Proteos Other HiLoad 16/600 Superdex 75-pg Size Exclusion Column Cytiva Catalog #28989333 For work done at Grifols Other Superdex 75 Size Exclusion Column Cytiva Catalog # dependent on size or quantity ordered For work done at Proteos Other PEIpro, linear Polyplus Catalog #115-01L For work done at Proteos Chemical compound 3,3′-Diaminobenzidine tetrahydrochloride (DAB) Sigma-Aldrich Catalog #D5905 Chemical compound Citrisolv Clearing Agent Decon Labs Catalog #22-143-975 Chemical compound Cytoseal Thermo Fisher Catalog #8310-4 Chemical compound Tissue Extraction Reagent I Thermo Fisher Catalog #FNN0071 Chemical compound, drug 2,2,2-tribromoethanol (Avertin) Sigma-Aldrich Catalog #T48402-25G 1.61 g/ml stock diluted 1:40 in sterile saline Chemical compound Corning Dulbecco’s PBS (DPBS) Spectrum Chemical Catalog #21-030-CM For dilution of TIMP2 constructs Chemical compound Paraformaldehyde (32% stock) Electron Microscopy Sciences Catalog #15714S 4% working solution made in PBS Chemical compound Sucrose Fisher Scientific Catalog #S5-3 30% w/v working solution made in PBS Chemical compound Ethylene glycol Fisher Scientific Catalog #E178-4 Chemical compound Glycerol Sigma-Aldrich Catalog #G5516 Chemical compound Ethylenediaminetetraacetic acid (EDTA) Boston BioProducts Catalog #BM-711 Chemical compound HBS-P+, 10× concentrated; 0.1 m HEPES, 1.5 m NaCl, 0.5 v/v Surfactant P20, pH 7.4 Cytiva Catalog #BR100671 Chemical compound BIA normalizing solution (70% glycerol) Cytiva Catalog #29207950 Chemical compound 10 mm glycine-HCl, pH 2.5 Cytiva Catalog #BR100356 Glycine 2.5 Chemical compound 50 mm sodium hydroxide Cytiva Catalog #BR100358 NaOH 50 Chemical compound 10 mm sodium acetate, pH 5.0 Cytiva Catalog #BR100351 Acetate 5.0 Chemical compound Bovine serum albumin, heat shock fraction, suitable for RIA, pH 5.2, ≥96% Sigma-Aldrich Catalog #A7888-100g BSA Chemical compound PBS 20×, pH 7.5, Ultra Pure VWR Catalog #E703-1L For work done at Grifols
Diluted to 1× in Milli-Q H2OChemical compound 10× PBS, pH 7.4 Corning Catalog #46-013-CM For work done at Proteos
Diluted to 1× in Milli-Q H2OChemical compound 100% Polyoxyethyenesorbitan monolaurate Sigma-Aldrich Catalog #P-7949 Tween 20 Chemical compound 1 m Tris-HCl, pH 8.0 Teknova Catalog #T1080 For work done at Grifols Chemical compound 1 m Tris-HCl, pH 8.0 Corning Catalog #46-031-CM For work done at Proteos Chemical compound 5 m NaCl Quality Biologicalalal Catalog #351-036-491 For work done at Grifols
Diluted to 1 m in Milli-Q H2OChemical compound 5 m NaCl Corning Catalog #46-032-CV For work done at Proteos Chemical compound 1 m NaOAc, pH 5.0 Teknova Catalog #S0391 For work done at Grifols
Diluted to 2 mm in Milli-Q H2OChemical compound NaOAc JT Baker Catalog #3470 For work done at Proteos
Working stock: 25 mm NaOAc, pH 5.0Chemical compound EXPI293 Expression Media Thermo Fisher Catalog #A1435102 For work done at Grifols Chemical compound F17 supplemented with 0.1% Pluronic F-68, 4 mm GlutaMAX, 25 μg/ml G418 Life Technologies Catalog # dependent on size or quantity ordered For work done at Proteos Commercial assay or kit Vectastain ABC kit Vector Laboratories Catalog #PK-4000 Commercial assay or kit Mouse TIMP-2 DuoSet ELISA R&D Systems Catalog #DY6304 Commercial assay or kit Human TIMP-2 DuoSet ELISA R&D Systems Catalog #DY971 Commercial assay or kit DuoSet ELISA Ancillary Reagent Kit 2 R&D Systems Catalog #DY008 Commercial assay or kit Mouse MMP2 ELISA kit Sigma-Aldrich Catalog #RAB0366 Commercial assay or kit SensoLyte 520 MMP-2 Assay kit, Fluorimetric AnaSpec Catalog #AS-71151 Commercial assay or kit SensoLyte 520 MMP-3 Assay kit, Fluorimetric AnaSpec Catalog #AS-71152 Commercial assay or kit SensoLyte 520 MMP-9 Assay kit, Fluorimetric AnaSpec Catalog #AS-71155 Commercial assay or kit RNeasy Mini kit QIAGEN Catalog #74106 Commercial assay or kit Superscript III First-Strand Synthesis SuperMix kit Invitrogen Catalog #11752050 Commercial assay or kit Applied Biosystems SYBR Green PCR Master Mix Thermo Fisher Catalog #43-091-55 Commercial assay or kit Applied Biosystems TaqMan Multiplex Master Mix Thermo Fisher Catalog #44-842-63 Commercial assay or kit Amine Coupling kit Cytiva Catalog #BR100050 Commercial assay or kit EZ-Link NHS-PEG4-Biotin, No-Weigh Format Biotinlyation kit Thermo Fisher Catalog #A39259 Commercial assay or kit ExpiFectamine 293 Transfection kit Thermo Fisher Catalog #A14525 Sequence-based reagent Mouse Dcx (DCX) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00438400_m1Sequence-based reagent Mouse Tubb3 (β-tubulin III) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00727586_s1Sequence-based reagent Mouse Syn1 (Synapsin-1) qPCR primers Integrated DNA Technologies, Inc GGAAGGGATCACATTATTGAGG/TGCTTGTCTTCATCCTGGTG Sequence-based reagent Mouse Dlg4 (PSD-95) qPCR primers Integrated DNA Technologies, Inc CGCTACCAAGATGAAGACACG/CAATCACAGGGGGAGAATTG Sequence-based reagent Mouse Gria1 (GluR1) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00433753_m1Sequence-based reagent Mouse Grin2a (GluN2A) qPCR primers Integrated DNA Technologies, Inc TGATGAACCGCACTGACCCTA/GGAAGAACGTGGATGTCGGA Sequence-based reagent Mouse Slc2a1 (vGLUT1) qPCR primers Integrated DNA Technologies, Inc CCGGGCCTTGACCTTAGC/CCTCGAGCCGCTGAATTAAT Sequence-based reagent Mouse Gad1 (GAD1) qPCR primers Integrated DNA Technologies, Inc CCTTCGCCTGCAACCTCCTCGAAC/GCGCAGTTTGCTCCTCCCCGTTCTT Sequence-based reagent Mouse cfos (c-Fos) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00487425_m1Sequence-based reagent Mouse Creb1 (CREB1) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00501607_m1Sequence-based reagent Mouse Egr1 (EGR1) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00656724_m1Sequence-based reagent Mouse Il1a (IL-1α) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00439620_m1Sequence-based reagent Mouse Il1b (IL-1β) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00434228_m1Sequence-based reagent Mouse Il6 (IL-6) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00446190_m1Sequence-based reagent Mouse Ccl11 (Eotaxin) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00441238_m1Sequence-based reagent Mouse Nfkb (NFκB) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00476361_m1Sequence-based reagent Mouse Tnfa (TNFα) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00443258_m1Sequence-based reagent Mouse Cd68 (CD68) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm03047343_m1Sequence-based reagent Mouse Iba1 (Iba1) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00479862_g1Sequence-based reagent Mouse Cd11b (CD11b) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00434455_m1Sequence-based reagent Mouse Aqp4 (AQP4) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm00802131_m1Sequence-based reagent Mouse Gfap (GFAP) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm01253033_m1Sequence-based reagent Mouse Ggta1 (GGTA1) qPCR primers Thermo Fisher Catalog #4331182
Assay ID: Mm01333302_m1Software, algorithm ANY-Maze Stoelting Co RRID: SCR_014289 Software, algorithm Zen Zeiss Zen Blue 2.5
RRID: SCR_013672Software, algorithm Image-Pro Media Cybernetics, Inc Image-Pro 9.2
RRID: SCR_016879Software, algorithm SynapseCounter (ImageJ plugin) https://github.com/SynPuCo/SynapseCounter Software, algorithm QuantStudio Applied Biosystems QuantStudio 6
RRID: SCR_020239Software, algorithm GraphPad Prism GraphPad Software, Inc GraphPad Prism 8 RRID: SCR_002798 Software, algorithm Image Lab Bio-Rad Image Lab 6.0.1
RRID: SCR_014210Software, algorithm Astra Wyatt Technology Astra 7.3.2
RRID: SCR_016255Software, algorithm Unicorn Cytiva Unicorn 7.7
RRID: SCR_019958Software, algorithm Octet Analysis Studio ForteBio/Sartorius Octet Analysis Studio 12.2.2.26 Software, algorithm Masshunter Workstation Software Agilent Technologies Masshunter 9.0.9044.1 SP1 Software, algorithm EndoScan-V Charles River EndoScan-V version 6.0.2 Software, algorithm Biacore T200 Control and Evaluation Software Cytiva Biacore T200 Software 3.2.1
RRID: SCR_019718Table provides a description of the key resources used and manufacturing product numbers. N/A, not applicable.
Construct Identity
(intact mass)Concentration
(mg/ml; A280)Purity (%; R/NR,
SDS-PAGE)Aggregation
(SEC-MALS)Oligomerization
(SEC-MALS)Endotoxin
(EU/ml; LAL)TIMP2 Confirmed 1.57 82/100 None detected Monomer <0.1 TIMP2-hIgG4 Confirmed 1.89 100/85 <5% Dimer <0.1 Ala-TIMP2 Confirmed 2.47 75–81/100 None detected Monomer <0.1 All recombinant TIMP2 protein constructs were characterized for identity (intact mass), concentration [A280, adjusted with calculated extinction coefficient: TIMP2, Ala-TIMP2 Abs 0.1% (=1 g/l) = 1.525; TIMP2-hIgG4 Abs 0.1% (= 1 g/l) = 1.408)], purity (SDS-PAGE), oligomerization and aggregation (SEC-MALS), and endotoxin (LAL assay) characterization. “/” in Purity column used to separate Reduced and Nonreduced percentage values, not division. R, reducing; NR, non-reducing; EU, endotoxin unit; LAL, limulus amebocyte lysate; SEC, size exclusion chromatography; MALS, multi angle light scattering.
Modality Gene Vehicle TIMP2 TIMP2-hIgG4 Neuronal Dcx 1 ± 0.038 0.924 ± 0.059 1.169 ± 0.077 Tubb3 1 ± 0.030 1.032 ± 0.019 1.087 ± 0.031 Syn1 1 ± 0.041 0.865 ± 0.023 1.060 ± 0.048 Dlg4 1 ± 0.038 0.879 ± 0.032 0.953 ± 0.048 Gria1 1 ± 0.051 1.050 ± 0.085 0.870 ± 0.087 Grin2a 1 ± 0.036 0.977 ± 0.055 0.890 ± 0.039 Slc2a1 1 ± 0.035 0.906 ± 0.026 1.056 ± 0.041 Gad1 1 ± 0.033 1.059 ± 0.039 0.0919 ± 0.071 Immediate
early
genesCfos 1 ± 0.028 1.421 ± 0.136 1.923 ± 0.357 Creb1 1 ± 0.027 1.052 ± 0.024 0.940 ± 0.057 Egr1 1 ± 0.073 1.089 ± 0.068 1.387 ± 0.192 Microglia Cd68 1 ± 0.085 1.096 ± 0.080 0.955 ± 0.053 Iba1 1 ± 0.061 0.950 ± 0.060 0.960 ± 0.079 Cd11b 1 ± 0.057 1.176 ± 0.119 0.903 ± 0.110 Inflammatory Il1a 1 ± 0.089 1.086 ± 0.071 0.938 ± 0.105 Il1b 1 ± 0.239 0.884 ± 0.138 0.775 ± 0.184 Il6 1 ± 0.105 0.906 ± 0.069 0.913 ± 0.085 Ccl11 1 ± 0.077 1.174 ± 0.072 0.987 ± 0.080 Nfkb 1 ± 0.039 0.960 ± 0.053 0.879 ± 0.060 Tnfa 1 ± 0.119 0.874 ± 0.141 0.878 ± 0.108 Astrocytes Gfap 1 ± 0.071 1.025 ± 0.071 0.879 ± 0.078 Aqp4 1 ± 0.042 1.067 ± 0.063 0.850 ± 0.079 Ggta1 1 ± 0.066 1.031 ± 0.036 0.809 ± 0.095 Average gene expression relative to Gapdh measured by Taqman or SYBR qPCR from bulk hippocampal tissue for each treatment group. n = 9–13 mice per group. All data are shown as mean ± SEM.
- Table 5
Few significant changes in hippocampal gene expression following treatment with TIMP2 or TIMP2-hIgG4
Modality Gene TIMP2 TIMP2-
hIgG4Kruskal–Wallis
test statisticsNeuronal Dcx 0.6790 0.4208 H(2) = 4.646, p = 0.0980 Tubb3 0.8189 0.1729 H(2) = 2.939, p = 0.2300 Syn1 *0.0294 0.9810 H(2) = 10.31, p = 0.0058 Dlg4 0.0616 0.6662 H(2) = 4.667, p = 0.0970 Gria1 0.4569 0.8582 H(2) = 3.828, p = 0.1475 Grin2a >0.9999 0.1800 H(2) = 3.138, p = 0.2082 Slc2a1 0.1370 0.9185 H(2) = 6.614, p = 0.0366 Gad1 0.3957 >0.9999 H(2) = 3.438, p = 0.1793 Immediate
early
genesCfos *0.0173 **0.0087 H(2) = 9.773, p = 0.0075 Creb1 0.2678 >0.9999 H(2) = 3.817, p = 0.1483 Egr1 0.7935 0.1351 H(2) = 3.342, p = 0.1880 Microglia Cd68 0.6144 >0.9999 H(2) = 1.509, p = 0.4702 Iba1 >0.9999 >0.9999 H(2) = 0.2837, p = 0.8678 Cd11b 0.5904 0.9339 H(2) = 3.016, p = 0.2213 Inflammatory Il1a 0.7900 >0.9999 H(2) = 2.050, p = 0.3589 Il1b >0.9999 0.9233 H(2) = 0.9005, p = 0.6375 Il6 0.5032 >0.9999 H(2) = 1.516, p = 0.4686 Ccl11 0.1789 >0.9999 H(2) = 3.675, p = 0.1592 Nfkb 0.9367 0.1776 H(2) = 2.903, p = 0.2342 Tnfa 0.3888 >0.9999 H(2) = 1.687, p = 0.4301 Astrocytes Gfap >0.9999 >0.9999 H(2) = 0.7345, p = 0.6926 Aqp4 0.2516 0.3938 H(2) = 7.558, p = 0.0228 Ggta1 >0.9999 0.1737 H(2) = 5.146, p = 0.0763 Kruskal–Wallis test statistics and p-values of post hoc Dunn’s multiple comparisons tests for comparisons between average gene expression relative to Gapdh measured by Taqman or SYBR qPCR from bulk hippocampal tissue from Vehicle versus the TIMP2 and TIMP2-hIgG4 treatment groups. n = 9–13 mice per group.
% Inhibition TIMP2 TIMP2-hIgG4 Ala-TIMP2 10 nm 250 nm 4000 nm 10 nm 250 nm 4000 nm 10 nm 250 nm 4000 nm MMP1 1.58 99.30 109.56 −2.28 15.96 107.23 −0.35 0.70 −6.53 MMP2 76.53 99.46 100.98 13.28 99.69 100.49 2.17 7.76 94.59 MMP3 2.80 99.44 99.14 2.06 −0.19 99.43 −0.94 −0.19 95.42 MMP7 −0.67 1.84 100.20 1.34 19.43 100.00 4.19 3.18 89.70 MMP8 9.77 99.64 100.00 6.22 2.49 100.47 −0.71 −4.97 99.53 MMP9 1.21 98.62 100.00 3.28 4.84 99.52 4.15 5.18 98.06 MMP10 −1.83 −1.22 100.19 −0.86 98.28 100.00 1.03 1.20 0.92 MMP12 2.99 97.84 79.74 0.66 4.49 81.70 2.16 −0.33 76.47 MMP13 10.17 81.33 87.89 18.11 1.29 76.65 3.33 5.36 72.03 MMP14 0.89 −2.32 99.40 −3.39 −1.25 99.60 7.62 9.33 50.00 MMP15 91.08 100.20 98.41 26.82 100.00 99.21 0.45 −1.80 98.41 MMP17 50.54 91.30 97.39 27.79 92.99 98.17 −1.82 24.16 74.15 MMP19 1.05 99.34 101.24 −7.32 42.25 100.62 0.63 7.95 22.11 MMP20 0.52 94.50 99.77 3.09 90.03 98.60 −1.20 1.89 56.28 MMP24 41.01 97.36 101.66 30.70 96.88 101.66 11.51 33.09 88.38 Percent inhibition by TIMP2, TIMP-hIgG4, and Ala-TIMP2 on 15 MMPs at three concentrations (4000 nm, 250 nm, and 10 nm).
- Table 7
The alanine insertion into TIMP2 prevented MMP inhibitory activity at biologically relevant concentrations
IC50 (nm) MMP2 MMP3 MMP9 TIMP2 1.65 7.37 2.00 Ala-TIMP2 2321 1689 127.7 TIMP2-hIgG4 1.82 9.70 1.46e−5 The IC50 values (nm) of TIMP2, Ala-TIMP2, and TIMP2-hIgG4 inhibitory activity on MMP2, MMP3, and MMP9.
Ligand TIMP2 TIMP2-hIgG4 Ala-TIMP2 Binding method BLI (nm) SPR (RU) BLI (nm) SPR (RU) BLI (nm) SPR (RU) Ms-pro-MMP2 0.14 N.D. 0.016 N.D. 0.089 N.D. Ms-pro-MMP3 0.0058 N.D. 0.013 N.D. 0.013 N.D. Ms-pro-MMP9 0.010 N.D. 0.011 N.D. 0.0044 N.D. Hu-pro-MMP2.1 0.068 5603.6 0.017 563.87 0.070 4468.99 Hu-pro-MMP3 0.0051 337.9 0.016 249.31 0.014 −85.29 Hu-pro-MMP9 0.013 219.2 0.013 164.32 0.0076 18.63 Hu-pro-MMP2.2 0.38 1140.07 0.079 266.57 0.37 975.75 Hu-CD-MMP3 0.015 109.39 0.035 137.61 0.025 16.64 Hu-CD-MMP9 0.019 5.03 0.025 63.44 0.021 3.10 Binding level was analyzed by bio-layer interferometry (BLI) and surface plasmon resonance (SPR) to determine interaction relationships between the TIMP2 constructs and MMP proteins. Binding interactions were assessed for mouse pro- (zymogen) forms and two human forms [pro-, catalytic domain (CD)] of MMP2, MMP3, and MMP9. BLI was performed on Octet Red96e. SPR was performed on Biacore T200. N.D. = No data collected for that combination. N.B. = No binding observed for that combination. Bindings scale cutoffs determined from largest observed binding signal.
- Movie 1.
Subtle changes in c-Fos across the entire brain following TIMP2 treatment. C-Fos across the entire brain was detected using a 3D imaging of solvent-cleared organs (iDISCO) procedure. Movie was generated from individual images that represent the average of the difference between vehicle-treated and TIMP2-treated mice. Red color represents increased c-Fos in TIMP2 treatment relative to vehicle and green color represents decreased c-Fos in TIMP2 treatment relative to vehicle.
In this issue
