Article Figures & Data
Figures
- Figure 1.
Etv1 is expressed in a subset of Skn-1a-dependent taste cells. A, Single-color in situ hybridization studies to investigate the expression of Etv1 mRNA in taste buds in circumvallate (CvP; top) and fungiform (FuP; middle) papillae and in palate (bottom) of wild-type (WT; left) and Skn-1a−/− (right) mice. n = 3 for CvP, n = 1 for palate and FuP; n ≥ 9 sections for each experiment. Scale bars: CvP, 50 μm; FuP and palate, 25 μm. B, Double-fluorescence in situ hybridization of Etv1 (magenta) with marker genes (green) in the CvP (top), FuP (middle), and palate (bottom) taste buds in WT mice. White arrowheads indicate cells singly expressing Etv1. For each experiment: CvP, n ≥ 2, with ≥7 sections; FuP, n ≥ 2, with ≥18 sections; palate, n ≥ 1, with ≥9 sections. Scale bars: 25 μm. C, Double-labeling in situ hybridization to study expression of Scnn1a in Etv1+ taste cells: Scnn1a (dark purple; left), Etv1 (green; middle), and merged (right) images of FuP (top) and palate (bottom) taste buds of WT mice. Yellow arrowheads indicate cells co-expressing Scnn1a and Etv1; red arrowheads indicate cells expressing only Scnn1a. n = 3 for each experiment. Scale bars: 25 μm. Taste buds and basal epithelial-mesenchymal boundaries are indicated by broken lines.
- Figure 2.
Loss of expression of Etv1 mRNA in taste buds of Etv1C/C mice. A, Single-color in situ hybridization studies to investigate the expression of Etv1 mRNA in taste buds in circumvallate (CvP; top) and fungiform (FuP; middle) papillae and in palate (bottom) of wild-type (WT; left) control and Etv1C/C (right) mice. Taste buds in Etv1C/C mice are indicated by broken lines. n = 3 for CvP, n = 1 for FuP and palate; ≥9 sections for each experiment. Scale bars: CvP, 50 μm; FuP and palate, 25 μm. B, Expression of mRNA (top) and protein (middle and bottom) of Etv1 isoform(s) in the sensory neurons in the dorsal root ganglia of wild-type (WT; left) and Etv1C/C (right) embryos at embryonic day 15.5. Etv1-immunoreactive signals (magenta) were observed in the parvalbumin (PV, green)-expressing proprioceptive neurons (bottom). n = 3 for each experiment, 10 sections for each genotype. Scale bars: 100 μm (chromogenic images) and 50 μm (fluorescent images). C, Schematic structure of Etv1 gene and its CreERT2 knock-in allele. Boxes indicate exons. Protein coding regions are shaded. Primers used for PCR analyses are indicated by triangles (see Table 2). The reverse primer of the primer set C and primers 7R1 and 7R2 were used for 5’-RACE. CreERT2 sequence is inserted in front of the forward primer of the primer set N in the second exon of Etv1 (Extended Data Fig. 2-1). D, Gel image of agarose electrophoresis of qualitative PCR products from circumvallate papillae (CvP) and dorsal root ganglia (DRG) of wild-type (WT) and Etv1C/C mice. Predicted amplicon sizes by primer sets N and C are 172 and 198 bp, spanning from exon 2 to exon 5 and from exon 12 to exon 13, respectively. Lane M, 100-bp DNA ladder marker. E, F, qPCR analyses to detect the expression of Etv1 and/or Etv1-derived transcripts in DRG (E) and CvP (F) in WT and Etv1C/C mice. Open circles, individual data; white and red bars are the mean ± SD of WT and Etv1C/C mouse tissues, respectively. Significance was assessed by Welch’s t test. Primers used are sets N and C to DRG (E) and set C to CvP (F). n = 5 for WT mice; n = 4 for DRG and n = 5 for CvP for Etv1C/C mice.
- Figure 3.
Etv1 regulates the expression of T1R genes in taste cells. The expression of T1R taste receptor genes in taste buds was analyzed in circumvallate (A, B) and fungiform (C, D) papillae and soft palate (Extended Data Fig. 3-1) of wild-type (WT) and Etv1C/C mice. A, C, In situ hybridization analyses. Left, WT mice (n = 3; ≥9 sections for CvP, ≥27 sections for FuP). Right, Etv1C/C mice (n = 3; ≥9 sections for CvP, ≥27 sections for FuP). Scale bars: CvP, 50 μm and FuP, 25 μm. B, D, qPCR analyses. n = 5 for each genotype. Open circles, individual data; white and red bars are the mean ± SD of WT and Etv1C/C tissues, respectively. Significance was assessed by Welch’s t test.
- Figure 4.
Etv1 positively regulates expression of the Scnn1a sodium taste receptor gene. A, B, Double-label in situ hybridization demonstrates expression of Scnn1a in Skn-1a+ taste cells (A) and in Pkd2l1+ taste cells (B). Shown are Scnn1a (dark purple; left), Skn-1a or Pkd2l1 (green; middle), and overlaid (right) images of taste buds in fungiform papilla of wild-type (WT) and Etv1C/C mice. Yellow arrowheads indicate cells co-expressing Scnn1a with Skn-1a (A) or Pkd2l1 (B), and red arrowheads indicate cells expressing only Scnn1a. n = 3; 27 sections for each genotype (A); n = 2; 18 sections (B). Scale bars: 25 μm. C, qPCR analysis of Scnn1a in taste buds in fungiform papillae of WT and Etv1C/C mice. n = 5 for each genotype. Open circles, individual data; white and red bars are the mean ± SD of WT and Etv1C/C tissues, respectively. Significance was assessed by Welch’s t test.
- Figure 5.
Limited impact of Etv1 deficiency on expression of taste signaling genes necessary for T1R-mediated tastes. A, Expression of Gnat3, Plcb2, Trpm5, Calhm1, and Calhm3 that are partially co-expressed with Etv1 in circumvallate papillae of wild-type (WT; left) and Etv1C/C (right) mice by in situ hybridization. n = 1 for each genotype, for each experiment; 3 sections. Scale bars: 50 μm. B, qPCR analyses in taste buds in circumvallate papillae of WT and Etv1C/C mice. n = 5 for each genotype. Open circles, individual data; white and red bars are the mean ± SD of WT and Etv1C/C tissues, respectively. Significance was assessed by Welch’s t test. For results in fungiform papillae and soft palate, see Extended Data Figures 5-1 and 5-2, respectively.
- Figure 6.
Unaltered expression of genes that are not co-expressed with Etv1 by Etv1 deficiency. Expression of T2R genes, Pkd2l1, and Entpd2 was examined in circumvallate papillae of wild-type (WT) and Etv1C/C mice. A, C, E, In situ hybridization. T2R gene expression was examined using a mixture of probes to four T2R genes (Tas2r104, Tas2r105, Tas2r118, and Tas2r126). Left, WT. Right, Etv1C/C mice. For each genotype, n = 2, with 5 sections for T2R genes; n = 1, with 3 sections for Pkd2l1 and Entpd2. Scale bars: 50 μm. B, D, F, qPCR analyses. T2R genes used for in situ hybridization were individually measured (B). n = 5 for each genotype. Open circles, individual data; white and red bars are the mean ± SD of WT and Etv1C/C tissues, respectively. Significance was assessed by Welch’s t test. For results in fungiform papillae and soft palate, see Extended Data Figures 6-1 and 6-2, respectively.
- Figure 7.
Presence of CreER+ taste cells in Etv1-deficient taste buds. A, Triple-fluorescence labeling to study the impact of an Etv1 deficiency on the generation of Etv1+ taste cells in circumvallate papillae: Trpm5 (green; left) to identify Skn-1a-dependent taste cells, tdTomato (red; left middle) to identify Etv1+ taste cells, KCNQ1 (blue; right middle) that marks most taste bud cells, and merged images (right) of circumvallate taste buds of Etv1C/+; R26Tom/+ (top) and Etv1C/C; R26Tom/+ (bottom) mice. n = 2, with 6 sections for each experiment. B, Triple-fluorescence images for IP3R3 (to identify Skn-1a-dependent taste cells, green) and tdTomato (to identify Etv1+ taste cells, red), and Ddc (to identify sour taste cells, blue) in taste buds in circumvallate (CvP; left) and fungiform (FuP; center) papillae and palate (right) of Etv1C/+; R26Tom/+ (top) and Etv1C/C; R26Tom/+ (bottom) mice (n = 3 for each genotype). Taste buds and basal epithelial-mesenchymal boundaries are indicated by broken lines. Scale bars: 25 μm. C, D, Quantitative analyses of taste cell populations. The number of Skn-1a-dependent taste cells (C) and ratios of tdTomato+ cells to Skn-1a-dependent taste cells (D) in single taste bud profiles in the CvP, FuP, and palate were compared between Etv1C/+; R26Tom/+ (white bar) and Etv1C/C; R26Tom/+ (blue bar) mice. Data are expressed as the mean ± SD. Significance was assessed by Welch’s t test. For the populations of total taste bud cells and sour taste cells in single taste bud profiles, see Extended Data Figure 7-1.
- Figure 8.
Expression of Etv1-related transcripts in geniculate ganglion neurons. A, In situ hybridization to show the expression of Etv1 and/or Etv1-related transcripts in geniculate ganglia of wild-type mice. Black arrow indicates nonspecific staining in the trunk of facial nerve. Scale bar: 100 μm. B, Double-label in situ hybridization to study expression of P2x2 in Etv1+ neurons: Etv1 (green; left), P2x2 (magenta; middle), and merged (right) images of geniculate ganglia in wild-type (WT; top) and Etv1C/C (bottom) mice. White arrowheads, Etv1+P2x2+ neurons; white arrows, Etv1−P2x2+ neurons; and yellow arrows, Etv1+P2x2− neurons. Scale bars: 100 μm. C, qPCR analyses to detect the expression of Etv1 and/or Etv1-related transcripts in geniculate ganglia. Primers used are sets N and C (for details, see Fig. 2C; Table 2). n = 5 for WT; n = 4 for Etv1C/C mice. D, E, Ratio of Etv1+P2x2+ neurons to P2x2+ neurons (D) and ratio of P2x2+ neurons to total neurons (E) in geniculate ganglia in WT and Etv1C/C mice. n = 3 for each genotype. Data are expressed as the mean ± SD. Significance was assessed by Welch’s t test. F, P2X2-immunoreactive fiber projection into taste buds in fungiform papillae: bright field (left), P2X2 (green; left middle), KCNQ1 (magenta; right middle), and merged images (right) of fungiform papillae of WT (top) and Etv1C/C (bottom) mice. Fluorescent images of P2X2+ signals were merged images of serial z-stacks. n = 2, with 3–4 sections for each genotype. Scale bars: 20 μm. For results in circumvallate papillae and soft palate, see Extended Data Figure 8-1.
- Figure 9.
Etv1 deficiency in taste cells impairs neural responses to sweet, umami, and sodium tastes. A, Representative charts of chorda tympani nerve responses of wild-type (WT; top) and Etv1C/C (bottom) mice to taste solutions: 100 mm NH4Cl, 300 mm sucrose, 0.5 mm inositol monophosphate (IMP), 100 mm monosodium glutamate (MSG), 100 mm MSG with 0.5 mm IMP, 100 mm sodium chloride (NaCl), 100 mm NaCl with 100 μm amiloride (Ami), 30 mm denatonium, and 10 mm citric acid. Responses of 0.5 mm IMP (orange) and 100 mm MSG (purple) are depicted as shaded rectangles to clarify the synergy (yellow) in the response of 100 mm MSG with 0.5 mm IMP. Responses to NaCl are depicted as shaded rectangles for amiloride-sensitive (blue) and amiloride-insensitive (green) components. The bars under the traces show the duration (30 s) of the taste stimulus. B, Whole chorda tympani nerve responses of WT and Etv1C/C mice to sweet taste solutions. Left, Sucrose. Middle, Acesulfame K (AceK). Right, SC45647. C, Whole chorda tympani nerve responses of wild-type and Etv1C/C mice to umami taste solutions. Left, IMP. Middle, MSG. Right, MSG with 0.5 mm IMP. D, Whole chorda tympani nerve responses of WT and Etv1C/C mice to NaCl solutions. Amiloride-sensitive salt responses (AS component; middle) are measured by subtracting the amiloride-insensitive response (AI component; right) from the whole salt response (left). E, F, Whole chorda tympani nerve responses of WT (circles) and Etv1C/C (triangles) mice to bitter (E) and sour (F) taste solutions that are received by receptors other than T1Rs (n = 8 for each genotype). Significance was assessed by repeated-measures two-way ANOVA and the Sidak’s multiple comparison test. *Significantly different (p < 0.05) responses between genotypes. Data are expressed as the mean ± SEM; where error bars are not visible, they are smaller than the symbol depicting the mean. See Table 3 for statistical values.
Tables
Gene name Accession no. Probe region Etv1 BC005645 1–2486 Tas1r1 AF337040 765–2761 Tas1r2 AF337041 641–2804 Tas1r3 AF337039 525–2725 Tas2r104 BC148229 1–921 Tas2r105 AF227147 1–903 Tas2r118 BC104401 1–900 Tas2r126 NM_207028 73–899 Scnn1a BC133688 913–2333 Gnat3 AK040065 41–1019 Plcb2 BC145249 588–3123 Trpm5 AF228681 310–3491 Calhm1 LC270870 1–1407, 2148–2369 Calhm3 LC270871 1–1653 Pkd2l1 NM_181422 226–3275 Entpd2 NM_009849 20–1822 Gene Accession no. Amplified region Forward primer (5′–>3′) Reverse primer (5′–>3′) Gapdh BC085315 735–843 GCATGGCCTTCCGTGTTCCTA GATGCCTGCTTCACCACCTTCT Etv1 L10426 221–392 GCAAGTGCCTTACGTGGTCAC AGGTACCTGAGCTTCAGCAAG 1320–1517 CGTTGGGGCATTCAGAAGAAC TTCCATGTCCGTCTTCAGCAG Tas1r1 AF337040 1651–1795 ACAATCAGGTGCCTGTGTCAG TGGCAGGTGTGAAGCTCACTC Tas1r2 AF337041 1284–1446 TCGTCTATCCATGGCAGCTAC TAGGAGGCGATGCTTTGGAAG Tas1r3 AF337039 481–652 ACCTTCAACGGCACCCTTCAG CAGGTGAAGTCATCTGGATGC Gnat3 BC147839 530–679 GACTTAGACAGACTCACAGCC CTCTGATCTCTGGCCACCTAC Plcb2 NM_177568 1731–1857 CCTGGAGGTGACAGCTTATGA GAGCTCCGTGAAGGAAGAGAC Trpm5 AF228681 3320–3491 GGAAAACGGCACACAGAGTGG CCACAGTTCTGAGAGCTTGAG Calhm1 LC270870 535–665 TTGCGCTGCATCTCTCAGGCA TAGTGGGACCAGTACTTGCTC Calhm3 LC270871 453–571 GCAAGTGCAGCTCTTCCTAGC TCCAGCCGATGGCCTGTGACA Tas2r104 BC148229 488–635 ACATCCTGGCTGATCCACCTG ATTGCATCTGCCTGCTGTGTC Tas2r105 BC125541 160–318 TGACTGGCTTCCTTCTCATCG TCAGGTGATTCACAGTCATCC Tas2r118 BC104401 298–411 GCTGTCCTCTACTGTGTCAAG AGAAGCTATCAGAGCACCCAG Tas2r126 NM_207028 511–678 AAGGAGTGGAACAGAAGGCTG GTTGGGGTCTTGCAAGCTGTG Scnn1a NM_011324 2107–2259 GTCTGTGAAGTCCCAGGATTG ACCATCGTGACAGAGGGAGAC Pkd2l1 NM_181422 1715–1921 TGCCATCGACAATGCCAACAG CGCAGCCTTAGTAGGGTCTTG Entpd2 NM_009849 395–560 CATGCGCCTACTCAACCTGAC GTTCTCCAGCAGGTAGTTGGC - Table 3
Summary of statistical analyses of chorda tympani responses of wild-type (WT) and Etv1C/C mice to taste compounds
Quality Compound
(component)Genotype
(WT vs Etv1C/C)Concentration Interaction Concentration differing
significantly with p value*Sweet Sucrose F(1,14) = 43.3 p < 0.0001 F(1.274,17.83) = 249.2 p < 0.0001 F(2,28) = 32.5 p < 0.0001 100 mm (p = 0.0023) 300 mm (p = 0.0005) 1000 mm (p = 0.0002) Acesulfame K F(1,14) = 15.9 p = 0.0014 F(1.072,15.01) = 27.26 p < 0.0001 F(2,28) = 8.5 p = 0.0013 3 mm (p = 0.0036) 10 mm (p = 0.028) SC45647 F(1,14) = 26.0 p = 0.0002 F(1.269,17.76) = 58.94 p < 0.0001 F(2,44) = 52.3 p < 0.0001 0.1 mm (p = 0.0064) 0.3 mm (p = 0.0075) 1 mm (p = 0.0025) Umami Inosine F(1,14) = 48.9 p < 0.0001 F(1.759,24.63) = 15.34 p < 0.0001 F(2,28) = 12.1 p = 0.0002 0.5 mm (p = 0.0016) monophosphate (IMP) 1 mm (p = 0.0005) 3 mm (p = 0.0004) Monosodium F(1,14) = 68.5 p < 0.0001 F(1.669,23.37) = 408.9 p < 0.0001 F(2,28) = 80.6 p < 0.0001 30 mm (p = 0.0020) glutamate (MSG) 100 mm (p = 0.0002) 300 mm (p < 0.0001) MSG+IMPa F(1,14) = 172.0 p < 0.0001 F(1.340,18.76) = 43.54 p < 0.0001 F(2,28) = 0.28 p = 0.76 30 mm (p < 0.0001) 100 mm (p < 0.0001) 300 mm (p < 0.0001) Saltyb NaCl F(1,14) = 33.3 p < 0.0001 F(1.881,26.33) = 347.0 p < 0.0001 F(5,70) = 12.4 p < 0.0001 30 mm (p = 0.0013) 100 mm (p = 0.0007) 300 mm (p = 0.0022) 500 mm (p = 0.0081) 1000 mm (p = 0.033) (AS salt) F(1,14) = 53.6 p < 0.0001 F(1.704,23.85) = 38.07 p < 0.0001 F(5,70) = 21.7 p < 0.0001 30 mm (p = 0.0059) 100 mm (p = 0.0003) 300 mm (p = 0.0002) 500 mm (p = 0.0024) 1000 mm (p = 0.0095) (AI salt) F(1,14) = 20.3 p = 0.0005 F(1.637,22.92) = 1060 p < 0.0001 F(5,70) = 23.9 p < 0.0001 300 mm (p = 0.0029) 500 mm (p = 0.0006) 1000 mm (p = 0.0026) Bitter Denatonium F(1,14) = 0.0072 p = 0.93 F(1.224,17.13) = 119.8 p < 0.0001 F(2,28) = 1.1 p = 0.35 Sour Citric acid F(1,14) = 3.9 p = 0.068 F(1.368,19.15) = 230.8 p < 0.0001 F(2,28) = 0.4 p = 0.67 ↵* p < 0.05 according to post hoc Sidak’s multiple comparison test.
↵a MSG solutions with 0.5 mm IMP.
↵b Responses to NaCl were recorded in the absence and presence of amiloride so that amiloride-sensitive (AS) salt responses were calculated by subtracting amiloride-insensitive (AI) responses from whole NaCl responses.
Extended Data Figure 2-1
Schematic structures of Etv1 alleles and their transcripts. A, Schematic gene structures of wild-type and gene-targeted Etv1 alleles. Initial methionine codon of Etv1 gene is replaced by CreERT2 and nlslacZ together with PGK-Neo in Etv1CreERT2 and Etv1nlslacZ alleles, respectively (Arber et al., 2000; Taniguchi et al., 2011). Etv1ETS allele retains IRES-taulacZ and PGK-Neo in exon 11 to disrupt the ETS domain of Etv1 (Arber et al., 2000). B, Etv1 gene-derived transcripts in DRG. Etv1 mRNA was detected by qualitative and quantitative PCR, but 5’-RACE primarily amplified Etv1-v2 mRNAs. C, Etv1CreERT2 allele-derived transcripts in DRG. Etv1-like immunoreactivity and amplification of C-terminal coding region by PCR in Etv1C/C mice can be explained by the presence of Etv1 isoform b encoded by Etv1-v2 mRNA. Download Figure 2-1, TIF file.
Extended Data Figure 3-1
Etv1 regulates the expression of T1R genes in taste cells in palate. A, In situ hybridization demonstrates impact of Etv1 deficiency on expression of T1R taste receptor genes in taste buds in soft palate. Signals were developed overnight. Left, Wild-type (WT) mice (n = 3). Right, Etv1C/C mice (n = 3). Scale bars: 25 μm. B, qPCR analyses of T1R genes in wild-type control (WT) and Etv1C/C mice. n = 5 for each genotype. Open circles, Individual data. White and red bars are the mean ± SEM of WT and Etv1C/C tissues, respectively. Significance was assessed by Welch’s t test. C, D, In situ hybridization demonstrates impact of Etv1 deficiency on expression of Tas1r3 in taste buds in soft palate (C) and fungiform papillae (D). Signals were developed for 4 h. Left, WT mice (n = 3). Right, Etv1C/C mice (n = 3). Scale bars: 25 μm. Download Figure 3-1, TIF file.
Extended Data Figure 5-1
Impact of Etv1 deficiency on expression of taste signaling genes necessary for T1R-mediated tastes in fungiform papillae. A, Gnat3, Plcb2, Trpm5, Calhm1, and Calhm3 are partially co-expressed with Etv1 in fungiform papillae of wild-type (WT; left) and Etv1C/C (right) mice by in situ hybridization. n = 1 for each genotype, for each experiment; 9 sections. Scale bars: 25 μm. B, qPCR analyses in taste buds in fungiform papillae of WT and Etv1C/C mice. n = 5 for each genotype. Open circles, individual data; white and red bars are the mean ± SEM of WT and Etv1C/C tissues, respectively. Significance was assessed by Welch’s t test. Download Figure 5-1, TIF file.
Extended Data Figure 5-2
Impact of Etv1 deficiency on expression of taste signaling genes necessary for T1R-mediated tastes in palate. A, Gnat3, Plcb2, Trpm5, Calhm1, and Calhm3 are partially co-expressed with Etv1 in palate of wild-type (WT; left) and Etv1C/C (right) mice by in situ hybridization. n = 1 for each genotype, for each experiment; 9 sections. Scale bars: 25 μm. B, qPCR analyses in taste buds in palate of WT and Etv1C/C mice. n = 5 for each genotype. Open circles, individual data; white and red bars are the mean ± SEM of WT and Etv1C/C tissues, respectively. Significance was assessed by Welch’s t test. Download Figure 5-2, TIF file.
Extended Data Figure 6-1
Unaltered expression of genes that are not co-expressed with Etv1 in fungiform papillae of Etv1-deficient mice. Expression of T2R genes, Pkd2l1, and Entpd2 was examined in fungiform papillae of wild-type (WT) and Etv1C/C mice. A, C, D, In situ hybridization. Tas2r mix (A) refers to a mixture of probes to four T2R genes (Tas2r104, Tas2r105, Tas2r118, and Tas2r126). Left, wild-type (WT). Right, Etv1C/C mice. n = 1, with 9 sections for WT, and n = 2, with 18 sections for Etv1C/C for T2R genes; n = 2, with 18 sections for each genotype for Pkd2l1; n = 1, with 9 sections for each genotype for Entpd2. Scale bars: 25 μm. B, E, qPCR analyses. T2R genes used for in situ hybridization were individually measured (B), but Tas2r104, Tas2r118, and Tas2r126, as well as Pkd2l1, did not show reliable amplification even in WT mice. n = 5 for each genotype. Open circles, individual data; white and red bars are the mean ± SEM of WT and Etv1C/C tissues, respectively. Significance was assessed by Welch’s t test. Download Figure 6-1, TIF file.
Extended Data Figure 6-2
Impact of Etv1 deficiency on expression of genes that are not co-expressed with Etv1 in palate. Expression of T2R genes, Pkd2l1, and Entpd2 was examined in palate of wild-type (WT) and Etv1C/C mice. A, C, D, In situ hybridization. Tas2r mix (A) refers to a mixture of probes to four T2R genes (Tas2r104, Tas2r105, Tas2r118, and Tas2r126). Left, WT. Right, Etv1C/C mice. n = 1, with 9 sections for WT, and n = 2, with 18 sections for Etv1C/C for T2R genes; n = 2, with 18 sections for each genotype for Pkd2l1; n = 1, with 9 sections for each genotype for Entpd2. Scale bars: 25 μm. B, E, qPCR analyses. T2R genes used for in situ hybridization were individually measured (B). Pkd2l1 did not show reliable amplification even in WT mice. n = 5 for each genotype. Open circles, individual data; white and red bars are the mean ± SEM of WT and Etv1C/C tissues, respectively. Significance was assessed by Welch’s t test. Download Figure 6-2, TIF file.
Extended Data Figure 7-1
Little impact by Etv1 deficiency on taste bud cell populations. Numbers of KCNQ1+ (A) and Ddc+ (B) cells in single taste bud profiles in the CvP, FuP, and palate were compared between Etv1C/+; R26Tom/+ (white bar) and Etv1C/C; R26Tom/+ (blue bar) mice. Data are expressed as the mean ± SEM. Significance was assessed by Welch’s t test. Download Figure 7-1, TIF file.
Extended Data Figure 8-1
No obvious impact on P2X2-immunoreactive fiber projection into taste buds by Etv1 deficiency. Peripheral sensory fibers were immunohistochemically visualized using anti-P2X2 antibodies, and serial z-stacks were merged (green; left middle). Taste buds were labeled by KCNQ1 immunoreactivity (magenta; right middle) in the circumvallate papillae (A) and soft palate (B) of wild-type (WT; top) and Etv1C/C (bottom) mice. Fluorescence images together with confocal transmitted light images (left) were merged (right). P2X2+ fiber projection was predominantly observed in taste buds. n = 2, with 3–4 sections for each genotype. Scale bars: 20 μm. Download Figure 8-1, TIF file.
In this issue
