Archival ReportReversible Overexpression of Bace1-Cleaved Neuregulin-1 N-Terminal Fragment Induces Schizophrenia-Like Phenotypes in Mice
Section snippets
Generation of Human N1β Transgenic Mice
The BACE1-cleaved N-terminal fragment of human NRG1 β1a (N1β) was subcloned into the BamHI and NotI sites of pTRE2hyg vector (Clontech Laboratories, Mountain View, California). A linearized NheI fragment containing the transgene was used for transgenic mouse production. Five TRE-N1β founders in the C57BL/6-CBA(J) background were identified by polymerase chain reaction with primers (forward CATCGTGGAATCAAACGAGA; reverse TTTGCCCCCTCCATATAACA) and further confirmed by Southern blotting. The Tg-N1β
Generation of Transgenic Mice Expressing Nrg1-ntfβ Transgene
We have previously mapped Bace1 cleavage of Nrg1 to the site between amino acids F237 and M238, which is located 10 amino acids upstream of the transmembrane domain of the Nrg1 β1 isoform (7). This has been confirmed in separate studies 9, 14. To generate transgenic mice overexpressing Bace1-cleaved Nrg1 β1 isoform (Nrg1-ntfβ), we subcloned the corresponding fragment into a vector under the control of an inducible tetracycline responsive element (Figure 1A). The assembled construct was then
Discussion
The Nrg1 is an indispensable signaling molecule for the control of neural development and neuronal functions 35, 36, 37. The Nrg1 initiates its signaling activity by binding to its cognate tyrosine kinase receptor, consisting of an ErbB2/ErbB3 heterodimer or an ErbB4 homodimer, which induces a cascade of signaling events including phosphorylation of the downstream molecules Akt and Erk. Membrane-bound pro-Nrg1 protein seems to be inactive, because the EGF-like domain within the N-terminal
References (51)
- et al.
Axonal regulation of myelination by neuregulin 1
Curr Opin Neurobiol
(2006) - et al.
Neuregulin 1 and susceptibility to schizophrenia
Am J Hum Genet
(2002) Neuregulins: Functions, forms, and signaling strategies
Exp Cell Res
(2003)- et al.
Cleavage of neuregulin-1 by BACE1 or ADAM10 protein produces differential effects on myelination
J Biol Chem
(2011) - et al.
Impairment of spatial but not contextual memory in CaMKII mutant mice with a selective loss of hippocampal LTP in the range of the theta frequency
Cell
(1995) - et al.
Neuregulin-1/ErbB signaling serves distinct functions in myelination of the peripheral and central nervous system
Neuron
(2008) - et al.
Modeling cognitive endophenotypes of schizophrenia in mice
Trends Neurosci
(2009) - et al.
Amygdala or ventral hippocampal lesions at two early stages of life differentially affect open field behaviour later in life; an animal model of neurodevelopmental psychopathological disorders
Behav Brain Res
(2002) - et al.
The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: A review
Eur J Pharmacol
(2003) - et al.
Synaptic plasticity of NMDA receptors: Mechanisms and functional implications
Curr Opin Neurobiol
(2012)